Multiple sequence alignment - TraesCS6B01G329300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G329300 chr6B 100.000 2480 0 0 1 2480 578689534 578687055 0.000000e+00 4580.0
1 TraesCS6B01G329300 chr6B 99.316 2486 11 1 1 2480 549715234 549712749 0.000000e+00 4492.0
2 TraesCS6B01G329300 chr6B 99.368 633 4 0 1 633 549705957 549705325 0.000000e+00 1147.0
3 TraesCS6B01G329300 chr6B 99.209 632 5 0 1 632 578680250 578679619 0.000000e+00 1140.0
4 TraesCS6B01G329300 chr6B 86.316 190 26 0 2290 2479 219059623 219059812 8.990000e-50 207.0
5 TraesCS6B01G329300 chr6B 85.714 182 26 0 2290 2471 41978625 41978806 2.520000e-45 193.0
6 TraesCS6B01G329300 chr6A 90.504 1685 79 26 639 2274 506185511 506183859 0.000000e+00 2150.0
7 TraesCS6B01G329300 chr6D 92.482 1277 53 15 640 1901 364850042 364848794 0.000000e+00 1786.0
8 TraesCS6B01G329300 chr6D 80.741 405 22 14 1891 2244 364847848 364847449 5.260000e-67 265.0
9 TraesCS6B01G329300 chr7A 98.892 632 7 0 1 632 222946687 222946056 0.000000e+00 1129.0
10 TraesCS6B01G329300 chr7A 98.576 632 9 0 1 632 708346302 708345671 0.000000e+00 1118.0
11 TraesCS6B01G329300 chr7A 98.420 633 10 0 1 633 18032992 18033624 0.000000e+00 1114.0
12 TraesCS6B01G329300 chr7A 78.075 187 24 7 464 635 260850075 260849891 4.360000e-18 102.0
13 TraesCS6B01G329300 chr2B 98.891 631 7 0 1 631 781782768 781783398 0.000000e+00 1127.0
14 TraesCS6B01G329300 chr2B 93.595 484 24 2 151 634 526838995 526838519 0.000000e+00 715.0
15 TraesCS6B01G329300 chr2B 82.178 404 56 14 10 411 799647475 799647086 1.420000e-87 333.0
16 TraesCS6B01G329300 chr2B 89.286 196 18 3 2286 2480 669948313 669948506 2.460000e-60 243.0
17 TraesCS6B01G329300 chr2B 86.911 191 23 2 2290 2480 95750652 95750464 1.930000e-51 213.0
18 TraesCS6B01G329300 chr2B 100.000 28 0 0 868 895 7657758 7657785 4.000000e-03 52.8
19 TraesCS6B01G329300 chr5B 88.421 190 20 2 2291 2480 576918579 576918766 6.900000e-56 228.0
20 TraesCS6B01G329300 chr5B 87.958 191 21 2 2290 2480 57957332 57957144 8.930000e-55 224.0
21 TraesCS6B01G329300 chr3D 86.458 192 24 1 2288 2479 373510627 373510816 2.500000e-50 209.0
22 TraesCS6B01G329300 chr7D 86.316 190 24 1 2290 2479 518044274 518044087 3.230000e-49 206.0
23 TraesCS6B01G329300 chr1A 100.000 28 0 0 867 894 577838069 577838096 4.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G329300 chr6B 578687055 578689534 2479 True 4580.0 4580 100.0000 1 2480 1 chr6B.!!$R4 2479
1 TraesCS6B01G329300 chr6B 549712749 549715234 2485 True 4492.0 4492 99.3160 1 2480 1 chr6B.!!$R2 2479
2 TraesCS6B01G329300 chr6B 549705325 549705957 632 True 1147.0 1147 99.3680 1 633 1 chr6B.!!$R1 632
3 TraesCS6B01G329300 chr6B 578679619 578680250 631 True 1140.0 1140 99.2090 1 632 1 chr6B.!!$R3 631
4 TraesCS6B01G329300 chr6A 506183859 506185511 1652 True 2150.0 2150 90.5040 639 2274 1 chr6A.!!$R1 1635
5 TraesCS6B01G329300 chr6D 364847449 364850042 2593 True 1025.5 1786 86.6115 640 2244 2 chr6D.!!$R1 1604
6 TraesCS6B01G329300 chr7A 222946056 222946687 631 True 1129.0 1129 98.8920 1 632 1 chr7A.!!$R1 631
7 TraesCS6B01G329300 chr7A 708345671 708346302 631 True 1118.0 1118 98.5760 1 632 1 chr7A.!!$R3 631
8 TraesCS6B01G329300 chr7A 18032992 18033624 632 False 1114.0 1114 98.4200 1 633 1 chr7A.!!$F1 632
9 TraesCS6B01G329300 chr2B 781782768 781783398 630 False 1127.0 1127 98.8910 1 631 1 chr2B.!!$F3 630

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
679 680 0.530744 GACACGTCATAGTGCCTGGA 59.469 55.0 0.0 0.0 45.45 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2297 3354 2.106683 GCAAGCCCTGCGTATTCGT 61.107 57.895 0.0 0.0 42.37 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
602 603 1.762370 CCCTTTTTGTTGTCTTGCCCT 59.238 47.619 0.00 0.0 0.00 5.19
620 621 1.287739 CCTGGGCCCCTAAAATCTCAA 59.712 52.381 22.27 0.0 0.00 3.02
679 680 0.530744 GACACGTCATAGTGCCTGGA 59.469 55.000 0.00 0.0 45.45 3.86
2404 3461 2.109431 ATGCGTGAACATGATGCCC 58.891 52.632 0.00 0.0 0.00 5.36
2453 3510 4.619394 GCCCGAATAGAGGATACATCACAG 60.619 50.000 0.00 0.0 41.41 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
350 351 8.526667 TCTAGCAGAAGTACTTGTATGATCTT 57.473 34.615 14.14 0.00 0.00 2.40
602 603 2.025321 GTCTTGAGATTTTAGGGGCCCA 60.025 50.000 27.72 8.13 0.00 5.36
620 621 2.038975 TCTTAGCAGGGCCGGTCT 59.961 61.111 5.77 5.74 0.00 3.85
679 680 2.825532 AGGCATTACGGACAAGCAAAAT 59.174 40.909 0.00 0.00 0.00 1.82
2297 3354 2.106683 GCAAGCCCTGCGTATTCGT 61.107 57.895 0.00 0.00 42.37 3.85
2404 3461 4.101448 CCTTGTCCCCCTGCTCCG 62.101 72.222 0.00 0.00 0.00 4.63
2415 3472 2.514824 GGCCGAGCATCCCTTGTC 60.515 66.667 0.00 0.00 0.00 3.18
2453 3510 2.485426 GGTCGGGTTTTGTAGGTTTAGC 59.515 50.000 0.00 0.00 0.00 3.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.