Multiple sequence alignment - TraesCS6B01G311600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G311600 chr6B 100.000 2745 0 0 1 2745 558815358 558818102 0.000000e+00 5070
1 TraesCS6B01G311600 chr6B 99.308 2747 16 3 1 2745 558732761 558735506 0.000000e+00 4964
2 TraesCS6B01G311600 chr6B 100.000 614 0 0 1881 2494 558896342 558896955 0.000000e+00 1134
3 TraesCS6B01G311600 chr6B 89.557 316 27 6 989 1301 561146400 561146088 1.980000e-106 396
4 TraesCS6B01G311600 chr6B 86.053 337 32 6 1392 1722 561145992 561145665 5.630000e-92 348
5 TraesCS6B01G311600 chr6B 87.004 277 36 0 1365 1641 561005292 561005016 2.050000e-81 313
6 TraesCS6B01G311600 chr6B 78.994 338 53 12 397 719 561013885 561014219 5.950000e-52 215
7 TraesCS6B01G311600 chrUn 98.285 933 3 5 376 1308 459911734 459912653 0.000000e+00 1622
8 TraesCS6B01G311600 chrUn 99.491 786 4 0 183 968 466369009 466368224 0.000000e+00 1430
9 TraesCS6B01G311600 chrUn 99.859 711 1 0 1130 1840 410292949 410293659 0.000000e+00 1308
10 TraesCS6B01G311600 chrUn 100.000 619 0 0 1876 2494 410293666 410294284 0.000000e+00 1144
11 TraesCS6B01G311600 chrUn 95.621 708 25 5 2041 2745 201290045 201290749 0.000000e+00 1131
12 TraesCS6B01G311600 chr6A 93.346 1082 49 9 786 1858 515035129 515034062 0.000000e+00 1578
13 TraesCS6B01G311600 chr6A 92.791 430 20 4 1 419 515057525 515057096 1.810000e-171 612
14 TraesCS6B01G311600 chr6A 87.088 364 35 8 1359 1722 515658081 515657730 4.260000e-108 401
15 TraesCS6B01G311600 chr6A 86.501 363 41 6 1361 1722 515643743 515643388 2.560000e-105 392
16 TraesCS6B01G311600 chr6A 87.654 324 31 7 452 769 515057095 515056775 4.320000e-98 368
17 TraesCS6B01G311600 chr6A 87.742 310 33 4 995 1301 515665722 515665415 9.350000e-95 357
18 TraesCS6B01G311600 chr5B 96.186 708 23 3 2041 2745 497221330 497222036 0.000000e+00 1155
19 TraesCS6B01G311600 chr7A 96.224 662 22 3 2055 2715 35219113 35219772 0.000000e+00 1081
20 TraesCS6B01G311600 chr7A 90.698 86 6 2 1 84 711169763 711169678 2.230000e-21 113
21 TraesCS6B01G311600 chr2D 94.225 710 33 7 2040 2745 102715220 102715925 0.000000e+00 1077
22 TraesCS6B01G311600 chr2D 90.698 86 6 2 1 84 628170106 628170021 2.230000e-21 113
23 TraesCS6B01G311600 chr6D 90.875 800 53 12 452 1243 372951520 372950733 0.000000e+00 1055
24 TraesCS6B01G311600 chr6D 90.976 543 32 6 1325 1858 372950715 372950181 0.000000e+00 715
25 TraesCS6B01G311600 chr6D 82.854 834 102 28 910 1722 373418600 373417787 0.000000e+00 710
26 TraesCS6B01G311600 chr6D 94.186 430 14 1 1 419 372951950 372951521 0.000000e+00 645
27 TraesCS6B01G311600 chr6D 88.688 442 30 5 823 1262 373049534 373049111 3.130000e-144 521
28 TraesCS6B01G311600 chr6D 87.017 362 41 3 1361 1722 373392027 373391672 1.180000e-108 403
29 TraesCS6B01G311600 chr6D 84.184 392 54 8 852 1236 373392517 373392127 9.280000e-100 374
30 TraesCS6B01G311600 chr6D 80.324 432 63 16 1304 1722 373279820 373279398 9.550000e-80 307
31 TraesCS6B01G311600 chr6D 91.628 215 17 1 412 626 373063403 373063190 2.070000e-76 296
32 TraesCS6B01G311600 chr6D 88.542 96 4 2 1201 1296 373280293 373280205 2.890000e-20 110
33 TraesCS6B01G311600 chr3A 88.858 709 63 14 2050 2745 726399651 726400356 0.000000e+00 857
34 TraesCS6B01G311600 chr3A 88.372 86 8 2 1 84 747056475 747056560 4.840000e-18 102
35 TraesCS6B01G311600 chr4D 89.016 701 60 15 2056 2745 222413720 222414414 0.000000e+00 852
36 TraesCS6B01G311600 chr4D 90.698 86 6 2 1 84 389491488 389491403 2.230000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G311600 chr6B 558815358 558818102 2744 False 5070.0 5070 100.000000 1 2745 1 chr6B.!!$F2 2744
1 TraesCS6B01G311600 chr6B 558732761 558735506 2745 False 4964.0 4964 99.308000 1 2745 1 chr6B.!!$F1 2744
2 TraesCS6B01G311600 chr6B 558896342 558896955 613 False 1134.0 1134 100.000000 1881 2494 1 chr6B.!!$F3 613
3 TraesCS6B01G311600 chr6B 561145665 561146400 735 True 372.0 396 87.805000 989 1722 2 chr6B.!!$R2 733
4 TraesCS6B01G311600 chrUn 459911734 459912653 919 False 1622.0 1622 98.285000 376 1308 1 chrUn.!!$F2 932
5 TraesCS6B01G311600 chrUn 466368224 466369009 785 True 1430.0 1430 99.491000 183 968 1 chrUn.!!$R1 785
6 TraesCS6B01G311600 chrUn 410292949 410294284 1335 False 1226.0 1308 99.929500 1130 2494 2 chrUn.!!$F3 1364
7 TraesCS6B01G311600 chrUn 201290045 201290749 704 False 1131.0 1131 95.621000 2041 2745 1 chrUn.!!$F1 704
8 TraesCS6B01G311600 chr6A 515034062 515035129 1067 True 1578.0 1578 93.346000 786 1858 1 chr6A.!!$R1 1072
9 TraesCS6B01G311600 chr6A 515056775 515057525 750 True 490.0 612 90.222500 1 769 2 chr6A.!!$R5 768
10 TraesCS6B01G311600 chr5B 497221330 497222036 706 False 1155.0 1155 96.186000 2041 2745 1 chr5B.!!$F1 704
11 TraesCS6B01G311600 chr7A 35219113 35219772 659 False 1081.0 1081 96.224000 2055 2715 1 chr7A.!!$F1 660
12 TraesCS6B01G311600 chr2D 102715220 102715925 705 False 1077.0 1077 94.225000 2040 2745 1 chr2D.!!$F1 705
13 TraesCS6B01G311600 chr6D 372950181 372951950 1769 True 805.0 1055 92.012333 1 1858 3 chr6D.!!$R4 1857
14 TraesCS6B01G311600 chr6D 373417787 373418600 813 True 710.0 710 82.854000 910 1722 1 chr6D.!!$R3 812
15 TraesCS6B01G311600 chr6D 373391672 373392517 845 True 388.5 403 85.600500 852 1722 2 chr6D.!!$R6 870
16 TraesCS6B01G311600 chr6D 373279398 373280293 895 True 208.5 307 84.433000 1201 1722 2 chr6D.!!$R5 521
17 TraesCS6B01G311600 chr3A 726399651 726400356 705 False 857.0 857 88.858000 2050 2745 1 chr3A.!!$F1 695
18 TraesCS6B01G311600 chr4D 222413720 222414414 694 False 852.0 852 89.016000 2056 2745 1 chr4D.!!$F1 689

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
968 991 1.602237 CTGGGCACACGGGAATAGT 59.398 57.895 0.0 0.0 0.0 2.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2547 3076 7.114866 TCCATCGGGTTTTTAAAAGAAAGTT 57.885 32.0 0.14 0.0 34.93 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
968 991 1.602237 CTGGGCACACGGGAATAGT 59.398 57.895 0.00 0.0 0.00 2.12
1128 1154 1.971149 TCCACTGGGAGGTGATCATT 58.029 50.000 0.00 0.0 38.64 2.57
2710 3242 5.382664 AAACTCTCTTAAAACCCAGTGGA 57.617 39.130 11.95 0.0 34.81 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
256 268 4.680171 AAACTAAATGCTACCTTGCGTC 57.320 40.909 0.00 0.00 35.36 5.19
968 991 4.357947 GTCGTGCGCACCTCCTCA 62.358 66.667 33.23 8.76 0.00 3.86
2547 3076 7.114866 TCCATCGGGTTTTTAAAAGAAAGTT 57.885 32.000 0.14 0.00 34.93 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.