Multiple sequence alignment - TraesCS6B01G311500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G311500 chr6B 100.000 2745 0 0 1 2745 558732763 558735507 0.000000e+00 5070
1 TraesCS6B01G311500 chr6B 99.308 2746 16 3 1 2745 558815360 558818103 0.000000e+00 4963
2 TraesCS6B01G311500 chr6B 100.000 614 0 0 1881 2494 558896342 558896955 0.000000e+00 1134
3 TraesCS6B01G311500 chr6B 89.557 316 27 6 989 1301 561146400 561146088 1.980000e-106 396
4 TraesCS6B01G311500 chr6B 85.757 337 33 6 1392 1722 561145992 561145665 2.620000e-90 342
5 TraesCS6B01G311500 chr6B 83.051 354 45 8 1365 1718 561005292 561004954 9.550000e-80 307
6 TraesCS6B01G311500 chr6B 79.290 338 54 10 395 719 561013885 561014219 3.560000e-54 222
7 TraesCS6B01G311500 chrUn 98.075 935 3 3 374 1308 459911734 459912653 0.000000e+00 1613
8 TraesCS6B01G311500 chrUn 99.239 788 4 2 181 968 466369009 466368224 0.000000e+00 1421
9 TraesCS6B01G311500 chrUn 99.437 711 4 0 1130 1840 410292949 410293659 0.000000e+00 1291
10 TraesCS6B01G311500 chrUn 99.838 619 1 0 1876 2494 410293666 410294284 0.000000e+00 1138
11 TraesCS6B01G311500 chrUn 95.628 709 24 6 2041 2745 201290045 201290750 0.000000e+00 1131
12 TraesCS6B01G311500 chr6A 93.161 1082 51 9 786 1858 515035129 515034062 0.000000e+00 1567
13 TraesCS6B01G311500 chr6A 93.224 428 18 4 1 417 515057523 515057096 1.080000e-173 619
14 TraesCS6B01G311500 chr6A 87.088 364 35 8 1359 1722 515658081 515657730 4.260000e-108 401
15 TraesCS6B01G311500 chr6A 86.501 363 41 6 1361 1722 515643743 515643388 2.560000e-105 392
16 TraesCS6B01G311500 chr6A 88.272 324 31 5 450 769 515057095 515056775 5.550000e-102 381
17 TraesCS6B01G311500 chr6A 87.742 310 33 4 995 1301 515665722 515665415 9.350000e-95 357
18 TraesCS6B01G311500 chr5B 96.192 709 22 4 2041 2745 497221330 497222037 0.000000e+00 1155
19 TraesCS6B01G311500 chr7A 96.252 667 22 3 2055 2720 35219113 35219777 0.000000e+00 1090
20 TraesCS6B01G311500 chr7A 90.476 84 6 2 1 82 711169761 711169678 2.890000e-20 110
21 TraesCS6B01G311500 chr2D 94.507 710 32 6 2040 2745 102715220 102715926 0.000000e+00 1088
22 TraesCS6B01G311500 chr2D 90.476 84 6 2 1 82 628170104 628170021 2.890000e-20 110
23 TraesCS6B01G311500 chr6D 91.125 800 53 10 450 1243 372951520 372950733 0.000000e+00 1068
24 TraesCS6B01G311500 chr6D 82.974 834 101 28 910 1722 373418600 373417787 0.000000e+00 715
25 TraesCS6B01G311500 chr6D 90.608 543 34 6 1325 1858 372950715 372950181 0.000000e+00 704
26 TraesCS6B01G311500 chr6D 94.626 428 12 1 1 417 372951948 372951521 0.000000e+00 652
27 TraesCS6B01G311500 chr6D 88.688 442 30 5 823 1262 373049534 373049111 3.130000e-144 521
28 TraesCS6B01G311500 chr6D 87.017 362 41 3 1361 1722 373392027 373391672 1.180000e-108 403
29 TraesCS6B01G311500 chr6D 84.694 392 52 8 852 1236 373392517 373392127 4.290000e-103 385
30 TraesCS6B01G311500 chr6D 80.093 432 64 16 1304 1722 373279820 373279398 4.440000e-78 302
31 TraesCS6B01G311500 chr6D 91.628 215 17 1 410 624 373063403 373063190 2.070000e-76 296
32 TraesCS6B01G311500 chr6D 88.542 96 4 2 1201 1296 373280293 373280205 2.890000e-20 110
33 TraesCS6B01G311500 chr4D 89.174 702 58 16 2056 2745 222413720 222414415 0.000000e+00 859
34 TraesCS6B01G311500 chr4D 90.476 84 6 2 1 82 389491486 389491403 2.890000e-20 110
35 TraesCS6B01G311500 chr3A 88.873 710 62 15 2050 2745 726399651 726400357 0.000000e+00 857
36 TraesCS6B01G311500 chr3A 88.095 84 8 2 1 82 747056477 747056560 6.260000e-17 99


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G311500 chr6B 558732763 558735507 2744 False 5070.0 5070 100.000000 1 2745 1 chr6B.!!$F1 2744
1 TraesCS6B01G311500 chr6B 558815360 558818103 2743 False 4963.0 4963 99.308000 1 2745 1 chr6B.!!$F2 2744
2 TraesCS6B01G311500 chr6B 558896342 558896955 613 False 1134.0 1134 100.000000 1881 2494 1 chr6B.!!$F3 613
3 TraesCS6B01G311500 chr6B 561145665 561146400 735 True 369.0 396 87.657000 989 1722 2 chr6B.!!$R2 733
4 TraesCS6B01G311500 chrUn 459911734 459912653 919 False 1613.0 1613 98.075000 374 1308 1 chrUn.!!$F2 934
5 TraesCS6B01G311500 chrUn 466368224 466369009 785 True 1421.0 1421 99.239000 181 968 1 chrUn.!!$R1 787
6 TraesCS6B01G311500 chrUn 410292949 410294284 1335 False 1214.5 1291 99.637500 1130 2494 2 chrUn.!!$F3 1364
7 TraesCS6B01G311500 chrUn 201290045 201290750 705 False 1131.0 1131 95.628000 2041 2745 1 chrUn.!!$F1 704
8 TraesCS6B01G311500 chr6A 515034062 515035129 1067 True 1567.0 1567 93.161000 786 1858 1 chr6A.!!$R1 1072
9 TraesCS6B01G311500 chr6A 515056775 515057523 748 True 500.0 619 90.748000 1 769 2 chr6A.!!$R5 768
10 TraesCS6B01G311500 chr5B 497221330 497222037 707 False 1155.0 1155 96.192000 2041 2745 1 chr5B.!!$F1 704
11 TraesCS6B01G311500 chr7A 35219113 35219777 664 False 1090.0 1090 96.252000 2055 2720 1 chr7A.!!$F1 665
12 TraesCS6B01G311500 chr2D 102715220 102715926 706 False 1088.0 1088 94.507000 2040 2745 1 chr2D.!!$F1 705
13 TraesCS6B01G311500 chr6D 372950181 372951948 1767 True 808.0 1068 92.119667 1 1858 3 chr6D.!!$R4 1857
14 TraesCS6B01G311500 chr6D 373417787 373418600 813 True 715.0 715 82.974000 910 1722 1 chr6D.!!$R3 812
15 TraesCS6B01G311500 chr6D 373391672 373392517 845 True 394.0 403 85.855500 852 1722 2 chr6D.!!$R6 870
16 TraesCS6B01G311500 chr6D 373279398 373280293 895 True 206.0 302 84.317500 1201 1722 2 chr6D.!!$R5 521
17 TraesCS6B01G311500 chr4D 222413720 222414415 695 False 859.0 859 89.174000 2056 2745 1 chr4D.!!$F1 689
18 TraesCS6B01G311500 chr3A 726399651 726400357 706 False 857.0 857 88.873000 2050 2745 1 chr3A.!!$F1 695

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1331 1733 2.063266 GTTTGACCGCTCGTGTTCATA 58.937 47.619 0.0 0.0 0.0 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2621 3151 6.645415 TCTCTCAAAGTTTCTCATAACGGTTC 59.355 38.462 0.0 0.0 33.26 3.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1331 1733 2.063266 GTTTGACCGCTCGTGTTCATA 58.937 47.619 0.0 0.0 0.0 2.15
1636 2137 2.032681 GCAGGGACCGAGCTGTTT 59.967 61.111 0.0 0.0 0.0 2.83
1879 2394 1.483415 CTCCCTCCGTCCCGAATTAAA 59.517 52.381 0.0 0.0 0.0 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
887 905 4.082190 TCGACACTTGCTAGTTAGATGCTT 60.082 41.667 0.00 0.0 30.26 3.91
1331 1733 0.971386 ACGTCTGGGTATCGTTTGGT 59.029 50.000 0.00 0.0 34.07 3.67
1636 2137 1.685077 CTCCTCCAGCTGCTCCTCA 60.685 63.158 8.66 0.0 0.00 3.86
1879 2394 1.396996 GCAAATACACCGTCGCTTCAT 59.603 47.619 0.00 0.0 0.00 2.57
2621 3151 6.645415 TCTCTCAAAGTTTCTCATAACGGTTC 59.355 38.462 0.00 0.0 33.26 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.