Multiple sequence alignment - TraesCS6B01G306400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G306400 chr6B 100.000 2691 0 0 1 2691 549715364 549712674 0.000000e+00 4970
1 TraesCS6B01G306400 chr6B 99.220 2691 15 1 1 2691 578689664 578686980 0.000000e+00 4848
2 TraesCS6B01G306400 chr6B 99.476 763 4 0 1 763 549706087 549705325 0.000000e+00 1387
3 TraesCS6B01G306400 chr6B 99.344 762 5 0 1 762 578680380 578679619 0.000000e+00 1380
4 TraesCS6B01G306400 chr6B 81.648 267 48 1 2426 2691 41978625 41978891 1.250000e-53 220
5 TraesCS6B01G306400 chr6A 90.124 1691 80 26 769 2410 506185511 506183859 0.000000e+00 2117
6 TraesCS6B01G306400 chr6D 91.972 1283 54 15 770 2037 364850042 364848794 0.000000e+00 1753
7 TraesCS6B01G306400 chr6D 80.741 405 22 14 2027 2380 364847848 364847449 5.710000e-67 265
8 TraesCS6B01G306400 chr2B 99.080 761 7 0 1 761 781782638 781783398 0.000000e+00 1367
9 TraesCS6B01G306400 chr2B 94.215 484 21 2 281 764 526838995 526838519 0.000000e+00 732
10 TraesCS6B01G306400 chr2B 81.728 405 59 10 138 541 473097301 473096911 9.290000e-85 324
11 TraesCS6B01G306400 chr2B 88.192 271 29 3 2422 2691 669948313 669948581 1.200000e-83 320
12 TraesCS6B01G306400 chr2B 94.611 167 8 1 1 166 526839446 526839280 9.560000e-65 257
13 TraesCS6B01G306400 chr7A 98.950 762 8 0 1 762 222946817 222946056 0.000000e+00 1363
14 TraesCS6B01G306400 chr7A 98.819 762 9 0 1 762 708346432 708345671 0.000000e+00 1358
15 TraesCS6B01G306400 chr7A 98.689 763 10 0 1 763 18032862 18033624 0.000000e+00 1354
16 TraesCS6B01G306400 chr7A 80.074 271 49 4 2422 2691 625679129 625678863 2.110000e-46 196
17 TraesCS6B01G306400 chr5B 89.098 266 27 2 2426 2691 57957332 57957069 2.000000e-86 329
18 TraesCS6B01G306400 chr5B 88.302 265 29 2 2427 2691 576918579 576918841 1.550000e-82 316
19 TraesCS6B01G306400 chr3A 86.842 266 33 2 2426 2691 101662174 101661911 2.030000e-76 296
20 TraesCS6B01G306400 chr3B 86.522 230 30 1 2462 2691 602492391 602492619 4.450000e-63 252
21 TraesCS6B01G306400 chr4D 85.650 223 23 2 2428 2649 337470072 337469858 2.700000e-55 226
22 TraesCS6B01G306400 chr2A 80.108 186 19 9 594 763 4754407 4754590 3.640000e-24 122


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G306400 chr6B 549712674 549715364 2690 True 4970.0 4970 100.0000 1 2691 1 chr6B.!!$R2 2690
1 TraesCS6B01G306400 chr6B 578686980 578689664 2684 True 4848.0 4848 99.2200 1 2691 1 chr6B.!!$R4 2690
2 TraesCS6B01G306400 chr6B 549705325 549706087 762 True 1387.0 1387 99.4760 1 763 1 chr6B.!!$R1 762
3 TraesCS6B01G306400 chr6B 578679619 578680380 761 True 1380.0 1380 99.3440 1 762 1 chr6B.!!$R3 761
4 TraesCS6B01G306400 chr6A 506183859 506185511 1652 True 2117.0 2117 90.1240 769 2410 1 chr6A.!!$R1 1641
5 TraesCS6B01G306400 chr6D 364847449 364850042 2593 True 1009.0 1753 86.3565 770 2380 2 chr6D.!!$R1 1610
6 TraesCS6B01G306400 chr2B 781782638 781783398 760 False 1367.0 1367 99.0800 1 761 1 chr2B.!!$F2 760
7 TraesCS6B01G306400 chr2B 526838519 526839446 927 True 494.5 732 94.4130 1 764 2 chr2B.!!$R2 763
8 TraesCS6B01G306400 chr7A 222946056 222946817 761 True 1363.0 1363 98.9500 1 762 1 chr7A.!!$R1 761
9 TraesCS6B01G306400 chr7A 708345671 708346432 761 True 1358.0 1358 98.8190 1 762 1 chr7A.!!$R3 761
10 TraesCS6B01G306400 chr7A 18032862 18033624 762 False 1354.0 1354 98.6890 1 763 1 chr7A.!!$F1 762

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
224 226 4.59085 AAGTGGAGCTTGGATTTTTGTC 57.409 40.909 0.0 0.0 35.8 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 2110 1.174783 CACTAGTAGGAGTGCCGTGT 58.825 55.0 1.45 0.0 40.42 4.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 56 6.513393 CGTGATTAATGGAAGAAGGTAATGCC 60.513 42.308 0.0 0.00 37.58 4.40
114 116 9.133627 GCAAATTCCTCTTTTTCTATGAACTTC 57.866 33.333 0.0 0.00 0.00 3.01
224 226 4.590850 AAGTGGAGCTTGGATTTTTGTC 57.409 40.909 0.0 0.00 35.80 3.18
1002 1237 3.660111 GCGCCACTTGACCACCAC 61.660 66.667 0.0 0.00 0.00 4.16
1003 1238 2.978010 CGCCACTTGACCACCACC 60.978 66.667 0.0 0.00 0.00 4.61
1004 1239 2.194597 GCCACTTGACCACCACCA 59.805 61.111 0.0 0.00 0.00 4.17
1005 1240 1.898574 GCCACTTGACCACCACCAG 60.899 63.158 0.0 0.00 0.00 4.00
1845 2110 1.406341 GCTGTGATTACTTGGCCGGTA 60.406 52.381 1.9 0.62 0.00 4.02
2540 3825 3.179925 ATGCGTGAACATGATGCCT 57.820 47.368 0.0 0.00 0.00 4.75
2589 3874 4.262463 GCCCGAATAGAGGATACATCACAA 60.262 45.833 0.0 0.00 41.41 3.33
2616 3901 0.183014 TACAAAACCCGACCCAAGCA 59.817 50.000 0.0 0.00 0.00 3.91
2675 3960 2.424302 CGAAACAGGGGACACCGT 59.576 61.111 0.0 0.00 46.96 4.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 56 6.203723 GGAGGTTGATCGGAATCTAGAAAATG 59.796 42.308 0.00 0.0 32.75 2.32
114 116 8.553696 TCATGAAACGAATGAATGATCTACATG 58.446 33.333 0.00 0.0 39.39 3.21
224 226 1.594862 GCTGCTGCTTATTAGTCACGG 59.405 52.381 8.53 0.0 36.03 4.94
1000 1235 2.981909 CTGGTGCTGGTGCTGGTG 60.982 66.667 0.00 0.0 40.48 4.17
1001 1236 4.962836 GCTGGTGCTGGTGCTGGT 62.963 66.667 0.00 0.0 40.48 4.00
1002 1237 4.960866 TGCTGGTGCTGGTGCTGG 62.961 66.667 0.00 0.0 40.48 4.85
1003 1238 3.667282 GTGCTGGTGCTGGTGCTG 61.667 66.667 0.00 0.0 40.48 4.41
1004 1239 4.962836 GGTGCTGGTGCTGGTGCT 62.963 66.667 0.00 0.0 40.48 4.40
1845 2110 1.174783 CACTAGTAGGAGTGCCGTGT 58.825 55.000 1.45 0.0 40.42 4.49
2540 3825 2.538141 CCCTTGTTCCCCTGCTCCA 61.538 63.158 0.00 0.0 0.00 3.86
2551 3836 2.044946 GGCCGAGCATCCCTTGTT 60.045 61.111 0.00 0.0 0.00 2.83
2589 3874 3.496692 GGGTCGGGTTTTGTAGGTTTAGT 60.497 47.826 0.00 0.0 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.