Multiple sequence alignment - TraesCS6B01G301600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G301600 chr6B 100.000 2534 0 0 1 2534 540589572 540592105 0.000000e+00 4680
1 TraesCS6B01G301600 chr6B 98.665 1723 17 1 810 2532 560198834 560197118 0.000000e+00 3049
2 TraesCS6B01G301600 chr6B 97.288 590 6 1 1 580 560199445 560198856 0.000000e+00 992
3 TraesCS6B01G301600 chr6D 92.689 2380 103 31 3 2344 358975511 358977857 0.000000e+00 3365
4 TraesCS6B01G301600 chr6D 92.708 96 7 0 2345 2440 358977931 358978026 3.400000e-29 139
5 TraesCS6B01G301600 chr6A 91.085 2479 82 43 3 2413 500504151 500506558 0.000000e+00 3225
6 TraesCS6B01G301600 chr3D 94.444 90 4 1 2438 2526 603266359 603266270 1.220000e-28 137
7 TraesCS6B01G301600 chr3D 92.473 93 6 1 2435 2526 455100571 455100663 5.690000e-27 132
8 TraesCS6B01G301600 chr5A 94.118 85 5 0 2439 2523 366233788 366233872 2.050000e-26 130
9 TraesCS6B01G301600 chr1B 93.182 88 6 0 2439 2526 562890134 562890047 2.050000e-26 130
10 TraesCS6B01G301600 chr4A 93.103 87 6 0 2438 2524 709209107 709209193 7.360000e-26 128
11 TraesCS6B01G301600 chr4D 92.135 89 7 0 2438 2526 317189954 317189866 2.650000e-25 126
12 TraesCS6B01G301600 chr3A 91.304 92 8 0 2432 2523 690192215 690192306 2.650000e-25 126
13 TraesCS6B01G301600 chr1A 93.023 86 6 0 2438 2523 394590629 394590544 2.650000e-25 126


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G301600 chr6B 540589572 540592105 2533 False 4680.0 4680 100.0000 1 2534 1 chr6B.!!$F1 2533
1 TraesCS6B01G301600 chr6B 560197118 560199445 2327 True 2020.5 3049 97.9765 1 2532 2 chr6B.!!$R1 2531
2 TraesCS6B01G301600 chr6D 358975511 358978026 2515 False 1752.0 3365 92.6985 3 2440 2 chr6D.!!$F1 2437
3 TraesCS6B01G301600 chr6A 500504151 500506558 2407 False 3225.0 3225 91.0850 3 2413 1 chr6A.!!$F1 2410

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
487 494 1.446907 AGAAGCCAAAGCGATGTGAG 58.553 50.0 0.0 0.0 46.67 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1983 2066 4.091509 CACTGAACTATGCCGTGTAACTTC 59.908 45.833 0.0 0.0 31.75 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
487 494 1.446907 AGAAGCCAAAGCGATGTGAG 58.553 50.000 0.0 0.0 46.67 3.51
948 1004 3.456380 TTTCCATTCCCTTCCTTGAGG 57.544 47.619 0.0 0.0 36.52 3.86
1254 1316 0.836400 TGGAGAAGGGCTTCGAGGTT 60.836 55.000 0.0 0.0 43.97 3.50
1983 2066 9.099454 GGACCACAATATACTAGTTCAGAAAAG 57.901 37.037 0.0 0.0 0.00 2.27
2532 2695 6.850234 AGAACGGAGGGAGTATATCTCTTAA 58.150 40.000 0.0 0.0 39.60 1.85
2533 2696 7.296098 AGAACGGAGGGAGTATATCTCTTAAA 58.704 38.462 0.0 0.0 39.60 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
453 460 2.599659 GCTTCTTTGATTGCTTTCCCG 58.400 47.619 0.00 0.0 0.00 5.14
634 659 0.612453 AACGTCTCCCTCAGTCCCTC 60.612 60.000 0.00 0.0 0.00 4.30
635 660 0.900647 CAACGTCTCCCTCAGTCCCT 60.901 60.000 0.00 0.0 0.00 4.20
636 661 1.186267 ACAACGTCTCCCTCAGTCCC 61.186 60.000 0.00 0.0 0.00 4.46
637 662 0.038159 CACAACGTCTCCCTCAGTCC 60.038 60.000 0.00 0.0 0.00 3.85
638 663 0.667792 GCACAACGTCTCCCTCAGTC 60.668 60.000 0.00 0.0 0.00 3.51
639 664 1.367840 GCACAACGTCTCCCTCAGT 59.632 57.895 0.00 0.0 0.00 3.41
757 782 2.098117 CGCCCATCTTTTCACTCATTCC 59.902 50.000 0.00 0.0 0.00 3.01
1167 1229 0.898320 CCTTCTTCTTGGAGAGCCGA 59.102 55.000 0.00 0.0 36.79 5.54
1254 1316 0.103572 GCTTCATCGGCGGGTACTTA 59.896 55.000 7.21 0.0 0.00 2.24
1404 1466 4.974721 GCCTGGTGGTGGTGGTGG 62.975 72.222 0.00 0.0 35.27 4.61
1983 2066 4.091509 CACTGAACTATGCCGTGTAACTTC 59.908 45.833 0.00 0.0 31.75 3.01
2508 2671 5.327737 AAGAGATATACTCCCTCCGTTCT 57.672 43.478 0.00 0.0 45.96 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.