Multiple sequence alignment - TraesCS6B01G299300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G299300 chr6B 100.000 3050 0 0 1 3050 537300136 537303185 0.000000e+00 5633
1 TraesCS6B01G299300 chr6B 97.774 2022 43 2 1 2021 453260570 453262590 0.000000e+00 3483
2 TraesCS6B01G299300 chr6B 91.640 1854 114 11 567 2395 702274903 702273066 0.000000e+00 2527
3 TraesCS6B01G299300 chr6B 97.019 1040 10 3 2032 3050 453262956 453263995 0.000000e+00 1729
4 TraesCS6B01G299300 chr6B 93.360 738 23 8 1678 2392 649862129 649861395 0.000000e+00 1068
5 TraesCS6B01G299300 chr6B 86.012 672 87 5 2385 3050 453277557 453278227 0.000000e+00 713
6 TraesCS6B01G299300 chr6B 85.757 674 87 6 2385 3050 537316692 537317364 0.000000e+00 704
7 TraesCS6B01G299300 chr6B 90.341 176 16 1 187 362 453277154 453277328 2.370000e-56 230
8 TraesCS6B01G299300 chr6B 90.341 176 16 1 187 362 537316289 537316463 2.370000e-56 230
9 TraesCS6B01G299300 chr7B 94.065 1803 81 4 618 2394 58877802 58876000 0.000000e+00 2713
10 TraesCS6B01G299300 chr7B 92.520 1845 99 8 572 2392 528023260 528021431 0.000000e+00 2606
11 TraesCS6B01G299300 chr7B 89.229 817 64 8 1588 2394 667783511 667782709 0.000000e+00 1000
12 TraesCS6B01G299300 chr7B 78.907 1299 205 43 1122 2389 56673147 56674407 0.000000e+00 817
13 TraesCS6B01G299300 chr3B 92.923 1851 103 8 569 2394 154826813 154824966 0.000000e+00 2667
14 TraesCS6B01G299300 chr3B 94.650 1701 65 8 717 2392 818935341 818933642 0.000000e+00 2614
15 TraesCS6B01G299300 chr3B 86.786 560 71 3 2492 3050 22208388 22208945 3.340000e-174 621
16 TraesCS6B01G299300 chr3B 86.179 492 55 8 2570 3050 22370767 22371256 1.250000e-143 520
17 TraesCS6B01G299300 chr3B 94.083 169 9 1 1 168 245966519 245966687 3.900000e-64 255
18 TraesCS6B01G299300 chr3B 78.933 375 72 7 2385 2755 22208207 22208578 6.530000e-62 248
19 TraesCS6B01G299300 chr5B 92.703 1850 104 12 569 2392 422050249 422052093 0.000000e+00 2639
20 TraesCS6B01G299300 chr5B 91.964 1655 96 15 771 2392 516459295 516457645 0.000000e+00 2285
21 TraesCS6B01G299300 chr5B 87.554 1848 178 33 569 2392 268436614 268434795 0.000000e+00 2091
22 TraesCS6B01G299300 chr4A 91.425 1831 131 9 574 2397 624340772 624342583 0.000000e+00 2488
23 TraesCS6B01G299300 chr2B 91.134 1861 124 21 567 2392 373297160 373295306 0.000000e+00 2484
24 TraesCS6B01G299300 chr2B 93.491 169 10 1 1 168 254292252 254292420 1.820000e-62 250
25 TraesCS6B01G299300 chr5A 89.623 636 49 9 1772 2392 673520300 673520933 0.000000e+00 793
26 TraesCS6B01G299300 chr5A 93.865 163 9 1 7 168 677829418 677829256 8.450000e-61 244
27 TraesCS6B01G299300 chr3A 88.357 627 47 10 1778 2392 22478562 22479174 0.000000e+00 730
28 TraesCS6B01G299300 chr3A 86.722 482 62 2 2570 3050 21012452 21011972 4.480000e-148 534
29 TraesCS6B01G299300 chr3A 79.208 303 60 2 2385 2684 21012568 21012266 1.110000e-49 207
30 TraesCS6B01G299300 chr3A 82.143 196 25 2 381 573 21012744 21012556 3.150000e-35 159
31 TraesCS6B01G299300 chr7D 82.121 660 113 4 2395 3050 2898771 2898113 7.380000e-156 560
32 TraesCS6B01G299300 chr7D 94.512 164 8 1 6 168 95085549 95085386 5.050000e-63 252
33 TraesCS6B01G299300 chr7A 78.793 580 98 22 1826 2392 631255291 631254724 1.730000e-97 366
34 TraesCS6B01G299300 chr6A 94.083 169 9 1 1 168 610916579 610916747 3.900000e-64 255
35 TraesCS6B01G299300 chr6A 78.706 371 75 4 2390 2758 431223592 431223224 8.450000e-61 244
36 TraesCS6B01G299300 chr6A 91.250 160 14 0 219 378 431223968 431223809 5.120000e-53 219
37 TraesCS6B01G299300 chr6A 85.326 184 27 0 194 377 431490401 431490218 1.120000e-44 191
38 TraesCS6B01G299300 chr1D 94.083 169 9 1 1 168 107613307 107613139 3.900000e-64 255
39 TraesCS6B01G299300 chr5D 93.491 169 9 2 1 168 363183053 363183220 1.820000e-62 250
40 TraesCS6B01G299300 chr5D 92.899 169 10 2 1 168 371281925 371282092 8.450000e-61 244
41 TraesCS6B01G299300 chr6D 78.364 379 74 7 2385 2758 291794856 291795231 3.930000e-59 239
42 TraesCS6B01G299300 chr6D 88.421 190 22 0 189 378 291794457 291794646 2.370000e-56 230
43 TraesCS6B01G299300 chr6D 85.227 176 26 0 202 377 291783646 291783821 6.720000e-42 182


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G299300 chr6B 537300136 537303185 3049 False 5633.0 5633 100.0000 1 3050 1 chr6B.!!$F1 3049
1 TraesCS6B01G299300 chr6B 453260570 453263995 3425 False 2606.0 3483 97.3965 1 3050 2 chr6B.!!$F2 3049
2 TraesCS6B01G299300 chr6B 702273066 702274903 1837 True 2527.0 2527 91.6400 567 2395 1 chr6B.!!$R2 1828
3 TraesCS6B01G299300 chr6B 649861395 649862129 734 True 1068.0 1068 93.3600 1678 2392 1 chr6B.!!$R1 714
4 TraesCS6B01G299300 chr6B 453277154 453278227 1073 False 471.5 713 88.1765 187 3050 2 chr6B.!!$F3 2863
5 TraesCS6B01G299300 chr6B 537316289 537317364 1075 False 467.0 704 88.0490 187 3050 2 chr6B.!!$F4 2863
6 TraesCS6B01G299300 chr7B 58876000 58877802 1802 True 2713.0 2713 94.0650 618 2394 1 chr7B.!!$R1 1776
7 TraesCS6B01G299300 chr7B 528021431 528023260 1829 True 2606.0 2606 92.5200 572 2392 1 chr7B.!!$R2 1820
8 TraesCS6B01G299300 chr7B 667782709 667783511 802 True 1000.0 1000 89.2290 1588 2394 1 chr7B.!!$R3 806
9 TraesCS6B01G299300 chr7B 56673147 56674407 1260 False 817.0 817 78.9070 1122 2389 1 chr7B.!!$F1 1267
10 TraesCS6B01G299300 chr3B 154824966 154826813 1847 True 2667.0 2667 92.9230 569 2394 1 chr3B.!!$R1 1825
11 TraesCS6B01G299300 chr3B 818933642 818935341 1699 True 2614.0 2614 94.6500 717 2392 1 chr3B.!!$R2 1675
12 TraesCS6B01G299300 chr3B 22208207 22208945 738 False 434.5 621 82.8595 2385 3050 2 chr3B.!!$F3 665
13 TraesCS6B01G299300 chr5B 422050249 422052093 1844 False 2639.0 2639 92.7030 569 2392 1 chr5B.!!$F1 1823
14 TraesCS6B01G299300 chr5B 516457645 516459295 1650 True 2285.0 2285 91.9640 771 2392 1 chr5B.!!$R2 1621
15 TraesCS6B01G299300 chr5B 268434795 268436614 1819 True 2091.0 2091 87.5540 569 2392 1 chr5B.!!$R1 1823
16 TraesCS6B01G299300 chr4A 624340772 624342583 1811 False 2488.0 2488 91.4250 574 2397 1 chr4A.!!$F1 1823
17 TraesCS6B01G299300 chr2B 373295306 373297160 1854 True 2484.0 2484 91.1340 567 2392 1 chr2B.!!$R1 1825
18 TraesCS6B01G299300 chr5A 673520300 673520933 633 False 793.0 793 89.6230 1772 2392 1 chr5A.!!$F1 620
19 TraesCS6B01G299300 chr3A 22478562 22479174 612 False 730.0 730 88.3570 1778 2392 1 chr3A.!!$F1 614
20 TraesCS6B01G299300 chr3A 21011972 21012744 772 True 300.0 534 82.6910 381 3050 3 chr3A.!!$R1 2669
21 TraesCS6B01G299300 chr7D 2898113 2898771 658 True 560.0 560 82.1210 2395 3050 1 chr7D.!!$R1 655
22 TraesCS6B01G299300 chr7A 631254724 631255291 567 True 366.0 366 78.7930 1826 2392 1 chr7A.!!$R1 566
23 TraesCS6B01G299300 chr6A 431223224 431223968 744 True 231.5 244 84.9780 219 2758 2 chr6A.!!$R2 2539
24 TraesCS6B01G299300 chr6D 291794457 291795231 774 False 234.5 239 83.3925 189 2758 2 chr6D.!!$F2 2569

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
825 828 1.061411 CACATCAATGCGCACGAGG 59.939 57.895 14.9 17.26 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2524 3100 7.119262 AGTCTAATTTTGGTGGAATTACACTCG 59.881 37.037 20.14 0.0 41.09 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 3.181497 CCGTTGCCTAAAATGATGGTCTG 60.181 47.826 0.00 0.00 0.00 3.51
124 125 3.942829 TGATGGTCTGTAAGGCAAGAAG 58.057 45.455 0.00 0.00 43.51 2.85
128 129 3.391296 TGGTCTGTAAGGCAAGAAGAAGT 59.609 43.478 0.00 0.00 43.51 3.01
155 156 1.831652 CTCCTCCGTGCAAGGGTTCT 61.832 60.000 19.08 0.00 43.84 3.01
399 402 4.039973 CACCTTGAGTAACTGGAGTACCAA 59.960 45.833 0.00 0.00 46.32 3.67
475 478 1.198178 GTCTCGTCACTTCTTCTCGCT 59.802 52.381 0.00 0.00 0.00 4.93
476 479 2.415857 GTCTCGTCACTTCTTCTCGCTA 59.584 50.000 0.00 0.00 0.00 4.26
726 729 2.122167 AAACTTGCGCCGGGTTTGA 61.122 52.632 17.28 0.00 32.84 2.69
802 805 4.890207 GGTCACCTACCTCCCACT 57.110 61.111 0.00 0.00 45.75 4.00
825 828 1.061411 CACATCAATGCGCACGAGG 59.939 57.895 14.90 17.26 0.00 4.63
1301 1306 2.113139 CAACGGGTGGCACCTCTT 59.887 61.111 33.87 22.10 38.64 2.85
1406 1411 1.731720 GACGACCTGTACTACGACCT 58.268 55.000 0.00 0.00 0.00 3.85
1408 1413 0.649475 CGACCTGTACTACGACCTCG 59.351 60.000 0.00 0.00 46.33 4.63
2524 3100 4.274950 AGATCTCTCTGTAAACTCGCTAGC 59.725 45.833 4.06 4.06 0.00 3.42
2526 3102 2.352034 CTCTCTGTAAACTCGCTAGCGA 59.648 50.000 35.39 35.39 46.87 4.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 4.327680 ACATGGACTTCTTCTTGCCTTAC 58.672 43.478 0.00 0.00 0.00 2.34
124 125 0.461961 CGGAGGAGGACATGGACTTC 59.538 60.000 0.00 0.00 0.00 3.01
128 129 2.359169 GCACGGAGGAGGACATGGA 61.359 63.158 0.00 0.00 0.00 3.41
399 402 0.109342 CCAGTGACAGAAGTGGCCTT 59.891 55.000 3.32 0.00 33.94 4.35
726 729 0.814010 GTTTGGTGTCTGCCGTGACT 60.814 55.000 0.00 0.00 37.79 3.41
1436 1441 2.821366 CGTCCTGGAGCCATGTGC 60.821 66.667 0.00 0.00 41.71 4.57
2524 3100 7.119262 AGTCTAATTTTGGTGGAATTACACTCG 59.881 37.037 20.14 0.00 41.09 4.18
2526 3102 8.576442 CAAGTCTAATTTTGGTGGAATTACACT 58.424 33.333 20.14 2.05 41.09 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.