Multiple sequence alignment - TraesCS6B01G297200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G297200 chr6B 100.000 3587 0 0 1 3587 534000868 534004454 0.000000e+00 6625
1 TraesCS6B01G297200 chr6B 97.516 3503 48 29 1 3482 401413419 401416903 0.000000e+00 5951
2 TraesCS6B01G297200 chr6B 92.114 317 19 6 3271 3587 637161668 637161358 3.290000e-120 442
3 TraesCS6B01G297200 chr6B 92.739 303 17 5 3289 3587 401416619 401416920 1.980000e-117 433
4 TraesCS6B01G297200 chr2A 98.554 3596 20 17 1 3586 172553912 172550339 0.000000e+00 6324
5 TraesCS6B01G297200 chr7A 98.391 3604 30 28 1 3587 286988088 286984496 0.000000e+00 6309
6 TraesCS6B01G297200 chr4A 98.289 2922 27 21 1 2907 627590439 627593352 0.000000e+00 5097
7 TraesCS6B01G297200 chr2B 98.812 2861 24 10 1 2857 91072388 91075242 0.000000e+00 5086
8 TraesCS6B01G297200 chr2B 98.686 2207 16 13 1385 3587 91076083 91078280 0.000000e+00 3903
9 TraesCS6B01G297200 chr2B 91.776 1605 99 24 1774 3370 335406341 335407920 0.000000e+00 2202
10 TraesCS6B01G297200 chr7B 96.232 1778 57 7 1 1778 654102574 654104341 0.000000e+00 2904
11 TraesCS6B01G297200 chr7B 94.504 1765 91 6 1 1765 35217769 35219527 0.000000e+00 2717
12 TraesCS6B01G297200 chr7B 91.020 1715 103 36 1774 3469 725140849 725139167 0.000000e+00 2266
13 TraesCS6B01G297200 chr7B 93.375 317 17 4 3271 3587 654105735 654106047 1.950000e-127 466
14 TraesCS6B01G297200 chrUn 95.396 1781 75 6 1 1778 12543410 12541634 0.000000e+00 2828
15 TraesCS6B01G297200 chrUn 91.379 232 17 3 3357 3587 12540230 12540001 7.480000e-82 315
16 TraesCS6B01G297200 chr5B 94.790 1766 86 6 1 1765 3899478 3897718 0.000000e+00 2747
17 TraesCS6B01G297200 chr5A 91.838 1605 97 25 1774 3370 678286709 678288287 0.000000e+00 2207
18 TraesCS6B01G297200 chr1B 91.589 1605 100 25 1774 3370 36520944 36522521 0.000000e+00 2183
19 TraesCS6B01G297200 chr2D 89.140 221 21 3 3367 3587 506288637 506288854 4.560000e-69 272


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G297200 chr6B 534000868 534004454 3586 False 6625.0 6625 100.0000 1 3587 1 chr6B.!!$F1 3586
1 TraesCS6B01G297200 chr6B 401413419 401416920 3501 False 3192.0 5951 95.1275 1 3587 2 chr6B.!!$F2 3586
2 TraesCS6B01G297200 chr2A 172550339 172553912 3573 True 6324.0 6324 98.5540 1 3586 1 chr2A.!!$R1 3585
3 TraesCS6B01G297200 chr7A 286984496 286988088 3592 True 6309.0 6309 98.3910 1 3587 1 chr7A.!!$R1 3586
4 TraesCS6B01G297200 chr4A 627590439 627593352 2913 False 5097.0 5097 98.2890 1 2907 1 chr4A.!!$F1 2906
5 TraesCS6B01G297200 chr2B 91072388 91078280 5892 False 4494.5 5086 98.7490 1 3587 2 chr2B.!!$F2 3586
6 TraesCS6B01G297200 chr2B 335406341 335407920 1579 False 2202.0 2202 91.7760 1774 3370 1 chr2B.!!$F1 1596
7 TraesCS6B01G297200 chr7B 35217769 35219527 1758 False 2717.0 2717 94.5040 1 1765 1 chr7B.!!$F1 1764
8 TraesCS6B01G297200 chr7B 725139167 725140849 1682 True 2266.0 2266 91.0200 1774 3469 1 chr7B.!!$R1 1695
9 TraesCS6B01G297200 chr7B 654102574 654106047 3473 False 1685.0 2904 94.8035 1 3587 2 chr7B.!!$F2 3586
10 TraesCS6B01G297200 chrUn 12540001 12543410 3409 True 1571.5 2828 93.3875 1 3587 2 chrUn.!!$R1 3586
11 TraesCS6B01G297200 chr5B 3897718 3899478 1760 True 2747.0 2747 94.7900 1 1765 1 chr5B.!!$R1 1764
12 TraesCS6B01G297200 chr5A 678286709 678288287 1578 False 2207.0 2207 91.8380 1774 3370 1 chr5A.!!$F1 1596
13 TraesCS6B01G297200 chr1B 36520944 36522521 1577 False 2183.0 2183 91.5890 1774 3370 1 chr1B.!!$F1 1596

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
726 730 0.178953 AAAGCACAGTCAGCCCCATT 60.179 50.0 0.0 0.0 0.0 3.16 F
1805 1880 0.860457 AGTCCCCCTTTTGCCTTTCT 59.140 50.0 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2051 2128 5.854431 AACACGCACAAAAGTTTGAAAAT 57.146 30.435 10.66 0.0 40.55 1.82 R
3228 5763 4.161189 TGAAGCTTTTGGAAACATGGTTGA 59.839 37.500 0.00 0.0 42.32 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 224 2.335316 TTACGACAAGCACAAGGGTT 57.665 45.000 0.00 0.00 37.82 4.11
630 634 0.953471 CTGGCATTTGGGACGACGAA 60.953 55.000 0.00 0.00 0.00 3.85
726 730 0.178953 AAAGCACAGTCAGCCCCATT 60.179 50.000 0.00 0.00 0.00 3.16
934 943 4.081972 CAGCTCCTAATATGGTCGCTACAT 60.082 45.833 0.00 0.00 34.87 2.29
1805 1880 0.860457 AGTCCCCCTTTTGCCTTTCT 59.140 50.000 0.00 0.00 0.00 2.52
2032 2108 6.938507 ACATAAATGCCATGTTGTCATCTTT 58.061 32.000 0.00 0.00 32.72 2.52
2051 2128 8.160765 TCATCTTTCACACACCTTATCCTTTTA 58.839 33.333 0.00 0.00 0.00 1.52
2384 4785 9.971922 AAGAGTTCAATCAGGTAATTTCTTTTG 57.028 29.630 0.00 0.00 0.00 2.44
2385 4786 9.136323 AGAGTTCAATCAGGTAATTTCTTTTGT 57.864 29.630 0.00 0.00 0.00 2.83
3228 5763 7.446001 TTCAACCATTGTTTGAAAAAGCTTT 57.554 28.000 5.69 5.69 30.42 3.51
3343 5878 4.768583 TGCTTGAAAAAGCTTCAACCATT 58.231 34.783 11.39 0.00 45.66 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
83 84 4.040829 CACATTAGAGGTATGGATGGAGCA 59.959 45.833 0.00 0.00 0.00 4.26
630 634 1.073923 GGGAACAACTCACAGGATGGT 59.926 52.381 0.00 0.00 43.62 3.55
726 730 3.181474 GGAACACGGGGATGTTTTCAAAA 60.181 43.478 0.00 0.00 42.89 2.44
934 943 4.559300 GCTTGCCTCAACAAAATGCTCTTA 60.559 41.667 0.00 0.00 0.00 2.10
2032 2108 8.698973 TGAAAATAAAAGGATAAGGTGTGTGA 57.301 30.769 0.00 0.00 0.00 3.58
2051 2128 5.854431 AACACGCACAAAAGTTTGAAAAT 57.146 30.435 10.66 0.00 40.55 1.82
2383 4784 8.177119 AGGAAAGTAGATTGCAACAAAATACA 57.823 30.769 0.00 0.00 0.00 2.29
2384 4785 9.476202 AAAGGAAAGTAGATTGCAACAAAATAC 57.524 29.630 0.00 0.85 0.00 1.89
3228 5763 4.161189 TGAAGCTTTTGGAAACATGGTTGA 59.839 37.500 0.00 0.00 42.32 3.18
3418 5957 4.441792 AGCTTTTGGAAAACATGGTTGAC 58.558 39.130 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.