Multiple sequence alignment - TraesCS6B01G268500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G268500 chr6B 100.000 4770 0 0 1 4770 482838191 482833422 0 8809
1 TraesCS6B01G268500 chr6B 98.617 4773 58 7 1 4770 482818558 482813791 0 8442
2 TraesCS6B01G268500 chr7A 98.618 4775 59 5 1 4770 28244723 28249495 0 8445
3 TraesCS6B01G268500 chr7B 98.617 4773 59 6 1 4770 75052088 75047320 0 8442
4 TraesCS6B01G268500 chr7B 98.534 4774 62 7 1 4770 628741839 628746608 0 8421
5 TraesCS6B01G268500 chr2B 98.556 4777 57 10 1 4770 615344294 615339523 0 8429
6 TraesCS6B01G268500 chr2B 98.408 4774 66 9 1 4770 616523000 616518233 0 8386
7 TraesCS6B01G268500 chr2A 98.492 4775 63 7 1 4770 167353552 167348782 0 8410
8 TraesCS6B01G268500 chr2A 98.645 4428 56 4 1 4426 70021020 70016595 0 7841
9 TraesCS6B01G268500 chr3A 98.450 4773 63 8 1 4770 742303657 742308421 0 8394


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G268500 chr6B 482833422 482838191 4769 True 8809 8809 100.000 1 4770 1 chr6B.!!$R2 4769
1 TraesCS6B01G268500 chr6B 482813791 482818558 4767 True 8442 8442 98.617 1 4770 1 chr6B.!!$R1 4769
2 TraesCS6B01G268500 chr7A 28244723 28249495 4772 False 8445 8445 98.618 1 4770 1 chr7A.!!$F1 4769
3 TraesCS6B01G268500 chr7B 75047320 75052088 4768 True 8442 8442 98.617 1 4770 1 chr7B.!!$R1 4769
4 TraesCS6B01G268500 chr7B 628741839 628746608 4769 False 8421 8421 98.534 1 4770 1 chr7B.!!$F1 4769
5 TraesCS6B01G268500 chr2B 615339523 615344294 4771 True 8429 8429 98.556 1 4770 1 chr2B.!!$R1 4769
6 TraesCS6B01G268500 chr2B 616518233 616523000 4767 True 8386 8386 98.408 1 4770 1 chr2B.!!$R2 4769
7 TraesCS6B01G268500 chr2A 167348782 167353552 4770 True 8410 8410 98.492 1 4770 1 chr2A.!!$R2 4769
8 TraesCS6B01G268500 chr2A 70016595 70021020 4425 True 7841 7841 98.645 1 4426 1 chr2A.!!$R1 4425
9 TraesCS6B01G268500 chr3A 742303657 742308421 4764 False 8394 8394 98.450 1 4770 1 chr3A.!!$F1 4769

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
458 467 1.826054 CCCACACTCCAAAACGGCA 60.826 57.895 0.0 0.0 33.14 5.69 F
2015 2025 2.096248 AGAAACTGAACAAAACCGGCA 58.904 42.857 0.0 0.0 0.00 5.69 F
2298 2308 7.989741 CCAAGTACCAGAAGTATCAGATGAAAT 59.010 37.037 0.0 0.0 32.28 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2298 2308 3.181486 CGTCTCTAAAGATGTGGCAGCTA 60.181 47.826 0.0 0.0 34.38 3.32 R
2978 2988 1.021390 CCTCACATCTGTTCACGGGC 61.021 60.000 0.0 0.0 0.00 6.13 R
4111 4127 2.297033 ACGACGGGCTTACTAAGAAACA 59.703 45.455 0.0 0.0 0.00 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.637184 ACGTCCGGGCAGTATTTTT 57.363 47.368 6.96 0.00 0.00 1.94
458 467 1.826054 CCCACACTCCAAAACGGCA 60.826 57.895 0.00 0.00 33.14 5.69
622 631 3.083349 CCGGTGCCTCTCCCATCA 61.083 66.667 0.00 0.00 0.00 3.07
812 821 7.865385 CAGAAATTCAGGTTTTATGAAACGGAA 59.135 33.333 15.95 15.95 44.83 4.30
1224 1233 6.090358 GTCTCATGAATACGTTCCGAAAAAGA 59.910 38.462 0.00 0.00 33.26 2.52
1292 1301 4.218200 TGGAATGCATTCACTTCACGATTT 59.782 37.500 34.08 0.20 38.53 2.17
2015 2025 2.096248 AGAAACTGAACAAAACCGGCA 58.904 42.857 0.00 0.00 0.00 5.69
2183 2193 9.504708 AAATGAATTTGCAAAAGGATGATAACA 57.495 25.926 17.19 2.99 0.00 2.41
2184 2194 9.504708 AATGAATTTGCAAAAGGATGATAACAA 57.495 25.926 17.19 0.00 0.00 2.83
2298 2308 7.989741 CCAAGTACCAGAAGTATCAGATGAAAT 59.010 37.037 0.00 0.00 32.28 2.17
2978 2988 2.036475 AGCAGAGTCGCATAGTAATGGG 59.964 50.000 9.14 0.00 45.08 4.00
3116 3126 6.426937 TGCAGACTTACATTCCTCTAAACAAC 59.573 38.462 0.00 0.00 0.00 3.32
3645 3657 1.535462 GAACGCTGTGCTAACACCATT 59.465 47.619 0.00 0.00 46.86 3.16
3740 3752 7.550196 ACAAGCTTGATGAAGTGAAAAACAAAT 59.450 29.630 32.50 0.00 0.00 2.32
3778 3790 4.712476 AGAAGAAGAAATAGATGCGGCAT 58.288 39.130 16.65 16.65 0.00 4.40
3885 3897 9.243637 GTAATAGACTCTGCTTCTGAATAGTTG 57.756 37.037 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 2.166907 TTTCCAGGCAGAAAACCCAA 57.833 45.000 0.77 0.00 32.90 4.12
622 631 1.787012 AAAACTTACACGACGGCGAT 58.213 45.000 22.49 7.75 41.64 4.58
1292 1301 5.741011 AGCTTACCAATCTCCGATAAACAA 58.259 37.500 0.00 0.00 0.00 2.83
1490 1500 3.631686 TGCCAACGGATCATATTTTGGAG 59.368 43.478 11.93 0.00 39.33 3.86
2015 2025 4.225267 CAGGTTACTGGGTTTGTAGGAGAT 59.775 45.833 0.00 0.00 41.13 2.75
2183 2193 4.613944 TCACGAGAAGTTACATCAACGTT 58.386 39.130 0.00 0.00 42.35 3.99
2184 2194 4.233123 TCACGAGAAGTTACATCAACGT 57.767 40.909 6.91 6.91 42.35 3.99
2298 2308 3.181486 CGTCTCTAAAGATGTGGCAGCTA 60.181 47.826 0.00 0.00 34.38 3.32
2978 2988 1.021390 CCTCACATCTGTTCACGGGC 61.021 60.000 0.00 0.00 0.00 6.13
3116 3126 7.065803 ACGACAGTAATCCAGTGATTATTTTGG 59.934 37.037 0.00 0.00 43.47 3.28
3778 3790 2.655090 TCACATGCAAAACTCCTCCA 57.345 45.000 0.00 0.00 0.00 3.86
3885 3897 6.200475 GGAAAAGTGCCGAGTCTATTACATAC 59.800 42.308 0.00 0.00 0.00 2.39
4111 4127 2.297033 ACGACGGGCTTACTAAGAAACA 59.703 45.455 0.00 0.00 0.00 2.83
4555 4571 6.430616 GGAGCTGAGTATATAAACTAGTCGGT 59.569 42.308 0.00 0.00 30.65 4.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.