Multiple sequence alignment - TraesCS6B01G252800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G252800 chr6B 100.000 5325 0 0 1 5325 453276206 453281530 0.000000e+00 9834.0
1 TraesCS6B01G252800 chr6B 99.440 2858 16 0 2468 5325 537323021 537325878 0.000000e+00 5190.0
2 TraesCS6B01G252800 chr6B 99.314 2478 9 4 1 2472 537315338 537317813 0.000000e+00 4475.0
3 TraesCS6B01G252800 chr6B 83.353 1694 259 17 1352 3033 537302520 537304202 0.000000e+00 1544.0
4 TraesCS6B01G252800 chr6B 83.235 1694 261 17 1352 3033 453263330 453265012 0.000000e+00 1533.0
5 TraesCS6B01G252800 chr6B 85.936 839 76 17 64 874 537297235 537298059 0.000000e+00 857.0
6 TraesCS6B01G252800 chr6B 85.816 839 77 17 64 874 453247605 453248429 0.000000e+00 852.0
7 TraesCS6B01G252800 chr6B 77.467 1216 261 12 1830 3040 453156738 453157945 0.000000e+00 715.0
8 TraesCS6B01G252800 chr6A 82.407 2825 433 39 1573 4367 431223306 431220516 0.000000e+00 2405.0
9 TraesCS6B01G252800 chr6A 77.238 2368 419 74 276 2595 431491071 431488776 0.000000e+00 1277.0
10 TraesCS6B01G252800 chr6A 80.360 1278 190 29 495 1740 431224461 431223213 0.000000e+00 913.0
11 TraesCS6B01G252800 chr6A 90.972 432 34 5 64 492 431241147 431240718 1.290000e-160 577.0
12 TraesCS6B01G252800 chr6D 84.579 1673 227 23 64 1727 291793581 291795231 0.000000e+00 1631.0
13 TraesCS6B01G252800 chr6D 75.595 2143 475 38 1614 3738 291784152 291786264 0.000000e+00 1016.0
14 TraesCS6B01G252800 chr6D 76.938 1535 312 34 1521 3040 291795169 291796676 0.000000e+00 835.0
15 TraesCS6B01G252800 chr6D 93.920 477 18 1 4860 5325 368120484 368120008 0.000000e+00 710.0
16 TraesCS6B01G252800 chr6D 79.637 992 147 30 566 1543 291783275 291784225 0.000000e+00 662.0
17 TraesCS6B01G252800 chr6D 86.424 302 37 4 278 578 291782940 291783238 1.430000e-85 327.0
18 TraesCS6B01G252800 chr6D 100.000 36 0 0 22 57 460808097 460808132 3.440000e-07 67.6
19 TraesCS6B01G252800 chr4A 80.315 1524 279 13 1033 2541 740377716 740376199 0.000000e+00 1133.0
20 TraesCS6B01G252800 chr4A 79.782 1375 245 25 1031 2384 740853582 740854944 0.000000e+00 968.0
21 TraesCS6B01G252800 chr4A 93.542 480 20 1 4857 5325 733794931 733795410 0.000000e+00 704.0
22 TraesCS6B01G252800 chr4A 79.787 188 33 4 276 459 740447887 740447701 1.200000e-26 132.0
23 TraesCS6B01G252800 chr4A 84.956 113 17 0 349 461 733879734 733879622 1.210000e-21 115.0
24 TraesCS6B01G252800 chr3B 82.561 1101 166 19 1555 2639 22370783 22371873 0.000000e+00 946.0
25 TraesCS6B01G252800 chr3B 82.088 977 164 7 2062 3033 22209114 22210084 0.000000e+00 824.0
26 TraesCS6B01G252800 chr3B 76.324 1681 296 75 125 1737 22206945 22208591 0.000000e+00 806.0
27 TraesCS6B01G252800 chr3B 77.230 1480 230 53 231 1652 22369529 22370959 0.000000e+00 767.0
28 TraesCS6B01G252800 chr3B 84.869 727 102 6 1461 2185 22208388 22209108 0.000000e+00 726.0
29 TraesCS6B01G252800 chr3B 93.958 480 18 1 4857 5325 51123615 51124094 0.000000e+00 715.0
30 TraesCS6B01G252800 chr3B 79.345 397 77 5 2635 3029 22380605 22380998 1.890000e-69 274.0
31 TraesCS6B01G252800 chr7D 80.835 1054 198 4 1364 2415 2898771 2897720 0.000000e+00 824.0
32 TraesCS6B01G252800 chr5D 94.670 469 19 3 4857 5325 439296627 439297089 0.000000e+00 723.0
33 TraesCS6B01G252800 chr5B 93.737 479 19 1 4858 5325 55645523 55645045 0.000000e+00 708.0
34 TraesCS6B01G252800 chr5B 93.333 480 21 3 4857 5325 50548400 50548879 0.000000e+00 699.0
35 TraesCS6B01G252800 chr5B 100.000 36 0 0 22 57 492255489 492255454 3.440000e-07 67.6
36 TraesCS6B01G252800 chr5B 100.000 36 0 0 22 57 598614922 598614957 3.440000e-07 67.6
37 TraesCS6B01G252800 chr2D 94.243 469 16 1 4867 5324 605233244 605232776 0.000000e+00 706.0
38 TraesCS6B01G252800 chr2D 89.892 465 42 4 4860 5324 270826267 270825808 1.280000e-165 593.0
39 TraesCS6B01G252800 chr2D 100.000 36 0 0 22 57 15335781 15335746 3.440000e-07 67.6
40 TraesCS6B01G252800 chr1D 93.542 480 20 1 4857 5325 111495910 111496389 0.000000e+00 704.0
41 TraesCS6B01G252800 chrUn 79.501 722 125 18 1644 2356 23784557 23785264 4.790000e-135 492.0
42 TraesCS6B01G252800 chrUn 85.042 361 41 8 514 874 478857134 478856787 6.560000e-94 355.0
43 TraesCS6B01G252800 chrUn 100.000 36 0 0 22 57 358211146 358211181 3.440000e-07 67.6
44 TraesCS6B01G252800 chr1B 84.681 470 67 2 4856 5325 684739745 684739281 1.040000e-126 464.0
45 TraesCS6B01G252800 chr1B 100.000 37 0 0 21 57 603094125 603094161 9.570000e-08 69.4
46 TraesCS6B01G252800 chr4D 100.000 36 0 0 22 57 312750567 312750602 3.440000e-07 67.6
47 TraesCS6B01G252800 chr1A 100.000 36 0 0 22 57 561307740 561307705 3.440000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G252800 chr6B 453276206 453281530 5324 False 9834.000000 9834 100.000000 1 5325 1 chr6B.!!$F4 5324
1 TraesCS6B01G252800 chr6B 537323021 537325878 2857 False 5190.000000 5190 99.440000 2468 5325 1 chr6B.!!$F8 2857
2 TraesCS6B01G252800 chr6B 537315338 537317813 2475 False 4475.000000 4475 99.314000 1 2472 1 chr6B.!!$F7 2471
3 TraesCS6B01G252800 chr6B 537302520 537304202 1682 False 1544.000000 1544 83.353000 1352 3033 1 chr6B.!!$F6 1681
4 TraesCS6B01G252800 chr6B 453263330 453265012 1682 False 1533.000000 1533 83.235000 1352 3033 1 chr6B.!!$F3 1681
5 TraesCS6B01G252800 chr6B 537297235 537298059 824 False 857.000000 857 85.936000 64 874 1 chr6B.!!$F5 810
6 TraesCS6B01G252800 chr6B 453247605 453248429 824 False 852.000000 852 85.816000 64 874 1 chr6B.!!$F2 810
7 TraesCS6B01G252800 chr6B 453156738 453157945 1207 False 715.000000 715 77.467000 1830 3040 1 chr6B.!!$F1 1210
8 TraesCS6B01G252800 chr6A 431220516 431224461 3945 True 1659.000000 2405 81.383500 495 4367 2 chr6A.!!$R3 3872
9 TraesCS6B01G252800 chr6A 431488776 431491071 2295 True 1277.000000 1277 77.238000 276 2595 1 chr6A.!!$R2 2319
10 TraesCS6B01G252800 chr6D 291793581 291796676 3095 False 1233.000000 1631 80.758500 64 3040 2 chr6D.!!$F3 2976
11 TraesCS6B01G252800 chr6D 291782940 291786264 3324 False 668.333333 1016 80.552000 278 3738 3 chr6D.!!$F2 3460
12 TraesCS6B01G252800 chr4A 740376199 740377716 1517 True 1133.000000 1133 80.315000 1033 2541 1 chr4A.!!$R2 1508
13 TraesCS6B01G252800 chr4A 740853582 740854944 1362 False 968.000000 968 79.782000 1031 2384 1 chr4A.!!$F2 1353
14 TraesCS6B01G252800 chr3B 22369529 22371873 2344 False 856.500000 946 79.895500 231 2639 2 chr3B.!!$F4 2408
15 TraesCS6B01G252800 chr3B 22206945 22210084 3139 False 785.333333 824 81.093667 125 3033 3 chr3B.!!$F3 2908
16 TraesCS6B01G252800 chr7D 2897720 2898771 1051 True 824.000000 824 80.835000 1364 2415 1 chr7D.!!$R1 1051
17 TraesCS6B01G252800 chrUn 23784557 23785264 707 False 492.000000 492 79.501000 1644 2356 1 chrUn.!!$F1 712

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
122 123 2.230508 TCTGTATCGTGGCTCTTTCGTT 59.769 45.455 0.00 0.0 0.00 3.85 F
857 1073 4.387862 CCGTTACGCTTCAAATAACTGACT 59.612 41.667 0.00 0.0 0.00 3.41 F
1643 2010 3.644265 TCTGTAAACTTGCTAGTGGGTCA 59.356 43.478 0.36 0.0 34.01 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1632 1999 2.644676 GGAGGAATTTGACCCACTAGC 58.355 52.381 0.00 0.0 0.00 3.42 R
3134 4176 9.880157 GTAAAAGGTAGACCAACAATATGACTA 57.120 33.333 0.66 0.0 38.89 2.59 R
4854 5905 4.379143 GGACGTGCGGGCGAAAAC 62.379 66.667 0.00 0.0 35.59 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 7.518653 TCCTAGGGAGGTAGTATCATACACTAA 59.481 40.741 9.46 0.0 44.19 2.24
80 81 4.142425 CCTCTCGTCTACCCTCAAAGTAAC 60.142 50.000 0.00 0.0 0.00 2.50
122 123 2.230508 TCTGTATCGTGGCTCTTTCGTT 59.769 45.455 0.00 0.0 0.00 3.85
857 1073 4.387862 CCGTTACGCTTCAAATAACTGACT 59.612 41.667 0.00 0.0 0.00 3.41
1531 1826 7.116805 CACCAAAATTAGACCTGCTTTCAAATC 59.883 37.037 0.00 0.0 0.00 2.17
1632 1999 5.960683 CGTCGTAGATCTCTCTGTAAACTTG 59.039 44.000 0.00 0.0 40.67 3.16
1643 2010 3.644265 TCTGTAAACTTGCTAGTGGGTCA 59.356 43.478 0.36 0.0 34.01 4.02
3134 4176 4.243793 TCCCAATATTCGGGTTCATGTT 57.756 40.909 17.43 0.0 44.81 2.71
4975 6026 0.981183 AGACCACGGCAATGGACTTA 59.019 50.000 12.19 0.0 41.21 2.24
4991 6042 2.422479 GACTTATTGGCCTTTTCGACCC 59.578 50.000 3.32 0.0 0.00 4.46
5073 6124 0.179009 GGCTGCCCAAGATGAGCATA 60.179 55.000 7.66 0.0 35.64 3.14
5085 6136 3.817647 AGATGAGCATAAATCCGCTTTCC 59.182 43.478 0.00 0.0 38.99 3.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 6.264292 GGTAGACGAGAGGATGCATATGATAT 59.736 42.308 6.97 0.0 0.00 1.63
62 63 2.830321 AGGGTTACTTTGAGGGTAGACG 59.170 50.000 0.00 0.0 0.00 4.18
80 81 2.494918 CGTAGCTTCCACGGAGGG 59.505 66.667 0.00 0.0 38.24 4.30
857 1073 0.735978 CGCGACATTGAGTACCAGCA 60.736 55.000 0.00 0.0 0.00 4.41
1531 1826 7.419711 TTCTGGATAGGTTTAAGTAGGACAG 57.580 40.000 0.00 0.0 0.00 3.51
1632 1999 2.644676 GGAGGAATTTGACCCACTAGC 58.355 52.381 0.00 0.0 0.00 3.42
1643 2010 7.331089 AGTAAGTCTAGTTTGGGAGGAATTT 57.669 36.000 0.00 0.0 0.00 1.82
3134 4176 9.880157 GTAAAAGGTAGACCAACAATATGACTA 57.120 33.333 0.66 0.0 38.89 2.59
4854 5905 4.379143 GGACGTGCGGGCGAAAAC 62.379 66.667 0.00 0.0 35.59 2.43
5073 6124 2.178912 TCACGAAGGAAAGCGGATTT 57.821 45.000 0.00 0.0 0.00 2.17
5085 6136 2.738846 CCAGATTCACCAGTTCACGAAG 59.261 50.000 0.00 0.0 0.00 3.79
5185 6236 2.029844 GGCCAGTGAGTGTCGAAGC 61.030 63.158 0.00 0.0 0.00 3.86
5272 6323 3.374058 CACAGAACGGTTATTAGCCCAAG 59.626 47.826 0.00 0.0 0.00 3.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.