Multiple sequence alignment - TraesCS6B01G236900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G236900 chr6B 100.000 2924 0 0 1 2924 408661943 408664866 0.000000e+00 5400
1 TraesCS6B01G236900 chr6B 98.906 2926 30 2 1 2924 704850703 704847778 0.000000e+00 5225
2 TraesCS6B01G236900 chr7B 99.042 2924 27 1 1 2924 528879484 528882406 0.000000e+00 5243
3 TraesCS6B01G236900 chr5B 99.043 2925 25 3 1 2924 179227002 179229924 0.000000e+00 5243
4 TraesCS6B01G236900 chr5B 98.975 2926 28 2 1 2924 406870615 406867690 0.000000e+00 5236
5 TraesCS6B01G236900 chr2A 99.009 2926 25 4 1 2924 43380271 43383194 0.000000e+00 5240
6 TraesCS6B01G236900 chr2A 99.009 2925 26 3 1 2924 719453777 719456699 0.000000e+00 5238
7 TraesCS6B01G236900 chr2A 91.281 2741 143 41 221 2924 17677299 17674618 0.000000e+00 3650
8 TraesCS6B01G236900 chr2A 91.429 140 8 3 1 138 17677430 17677293 3.850000e-44 189
9 TraesCS6B01G236900 chr4B 98.634 2929 34 6 1 2924 194219138 194222065 0.000000e+00 5182
10 TraesCS6B01G236900 chr7A 98.429 2928 23 9 1 2924 171418632 171421540 0.000000e+00 5131
11 TraesCS6B01G236900 chr1A 99.099 2331 21 0 594 2924 567477552 567475222 0.000000e+00 4189


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G236900 chr6B 408661943 408664866 2923 False 5400.0 5400 100.000 1 2924 1 chr6B.!!$F1 2923
1 TraesCS6B01G236900 chr6B 704847778 704850703 2925 True 5225.0 5225 98.906 1 2924 1 chr6B.!!$R1 2923
2 TraesCS6B01G236900 chr7B 528879484 528882406 2922 False 5243.0 5243 99.042 1 2924 1 chr7B.!!$F1 2923
3 TraesCS6B01G236900 chr5B 179227002 179229924 2922 False 5243.0 5243 99.043 1 2924 1 chr5B.!!$F1 2923
4 TraesCS6B01G236900 chr5B 406867690 406870615 2925 True 5236.0 5236 98.975 1 2924 1 chr5B.!!$R1 2923
5 TraesCS6B01G236900 chr2A 43380271 43383194 2923 False 5240.0 5240 99.009 1 2924 1 chr2A.!!$F1 2923
6 TraesCS6B01G236900 chr2A 719453777 719456699 2922 False 5238.0 5238 99.009 1 2924 1 chr2A.!!$F2 2923
7 TraesCS6B01G236900 chr2A 17674618 17677430 2812 True 1919.5 3650 91.355 1 2924 2 chr2A.!!$R1 2923
8 TraesCS6B01G236900 chr4B 194219138 194222065 2927 False 5182.0 5182 98.634 1 2924 1 chr4B.!!$F1 2923
9 TraesCS6B01G236900 chr7A 171418632 171421540 2908 False 5131.0 5131 98.429 1 2924 1 chr7A.!!$F1 2923
10 TraesCS6B01G236900 chr1A 567475222 567477552 2330 True 4189.0 4189 99.099 594 2924 1 chr1A.!!$R1 2330

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
163 171 4.818534 TTGTGAAGAAGCAAGTGATGTC 57.181 40.909 0.00 0.0 0.00 3.06 F
1091 1128 4.000988 GCTCAAAATCCTGAGTTAACCGA 58.999 43.478 0.88 0.0 44.04 4.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1154 1191 0.614812 TGCAGGTGCTTGCTCATCTA 59.385 50.000 7.75 0.0 44.38 1.98 R
2637 2690 2.359850 GCTGCACCATCGACCCAA 60.360 61.111 0.00 0.0 0.00 4.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 171 4.818534 TTGTGAAGAAGCAAGTGATGTC 57.181 40.909 0.00 0.0 0.00 3.06
219 227 5.458015 GTTGGTACTTTTATTCACCAGTGC 58.542 41.667 0.00 0.0 41.84 4.40
731 766 7.341512 TCCTTGAAAACCATGCATATGTATGAA 59.658 33.333 28.94 15.9 39.98 2.57
969 1006 7.485810 TCAAACTAACTAGCTTTGGTTTTTCC 58.514 34.615 9.23 0.0 37.89 3.13
1091 1128 4.000988 GCTCAAAATCCTGAGTTAACCGA 58.999 43.478 0.88 0.0 44.04 4.69
1154 1191 2.624838 CTGTGGCAAAAACAGTGGAGAT 59.375 45.455 0.00 0.0 40.17 2.75
1344 1381 2.623416 GAGGTTTGACACTTTGGAAGGG 59.377 50.000 0.00 0.0 38.11 3.95
1392 1429 4.516321 GCCTTGCAGATTGGTTTTTCAATT 59.484 37.500 0.00 0.0 37.47 2.32
1522 1559 4.987963 ATTCCTGTGCTGGATGATATCA 57.012 40.909 8.10 8.1 35.83 2.15
2416 2469 6.099159 TCATTTTGACTCCATTGAATGCAA 57.901 33.333 0.00 0.0 38.60 4.08
2637 2690 9.225436 GAAGAAGACAGAGTGGAGAATATTTTT 57.775 33.333 0.00 0.0 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1091 1128 7.341769 GCACTATATGAGGAGTAGGAGAATCAT 59.658 40.741 0.00 0.0 36.25 2.45
1154 1191 0.614812 TGCAGGTGCTTGCTCATCTA 59.385 50.000 7.75 0.0 44.38 1.98
1344 1381 2.030007 TGCATTGTAGTGCTCTTTTGCC 60.030 45.455 0.00 0.0 45.27 4.52
1522 1559 7.608153 TCATCATCATCTTTTGTTTGCTCAAT 58.392 30.769 0.00 0.0 0.00 2.57
2637 2690 2.359850 GCTGCACCATCGACCCAA 60.360 61.111 0.00 0.0 0.00 4.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.