Multiple sequence alignment - TraesCS6B01G234700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G234700 chr6B 100.000 2378 0 0 1 2378 394497043 394499420 0 4392
1 TraesCS6B01G234700 chr6B 98.955 1723 15 3 1 1721 596656906 596655185 0 3079
2 TraesCS6B01G234700 chr1A 98.957 1726 13 3 1 1721 238109345 238107620 0 3083
3 TraesCS6B01G234700 chr1A 98.957 1726 13 3 1 1721 238154730 238153005 0 3083
4 TraesCS6B01G234700 chr7D 98.897 1723 17 2 1 1721 579015978 579017700 0 3075
5 TraesCS6B01G234700 chr5A 98.841 1726 15 3 1 1721 16577520 16575795 0 3072
6 TraesCS6B01G234700 chr5A 98.885 897 9 1 1482 2378 16614230 16613335 0 1600
7 TraesCS6B01G234700 chr5A 98.439 897 13 1 1482 2378 300057557 300058452 0 1578
8 TraesCS6B01G234700 chrUn 98.839 1722 15 3 1 1720 237257430 237255712 0 3064
9 TraesCS6B01G234700 chr7A 98.725 1726 17 3 1 1721 60328610 60326885 0 3061
10 TraesCS6B01G234700 chr7A 98.439 897 13 1 1482 2378 671951975 671951080 0 1578
11 TraesCS6B01G234700 chr7A 98.436 895 13 1 1484 2378 120917129 120916236 0 1574
12 TraesCS6B01G234700 chr3B 98.436 1726 20 5 1 1721 483372716 483374439 0 3031
13 TraesCS6B01G234700 chr3B 98.551 897 12 1 1482 2378 201626944 201626049 0 1583
14 TraesCS6B01G234700 chr1B 98.320 1726 22 5 1 1721 672508150 672506427 0 3020
15 TraesCS6B01G234700 chr7B 98.774 897 10 1 1482 2378 743074882 743075777 0 1594
16 TraesCS6B01G234700 chr7B 98.662 897 11 1 1482 2378 743104322 743103427 0 1589
17 TraesCS6B01G234700 chr2A 98.774 897 10 1 1482 2378 735181357 735182252 0 1594
18 TraesCS6B01G234700 chr6A 98.438 896 12 2 1484 2378 289117363 289118257 0 1576


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G234700 chr6B 394497043 394499420 2377 False 4392 4392 100.000 1 2378 1 chr6B.!!$F1 2377
1 TraesCS6B01G234700 chr6B 596655185 596656906 1721 True 3079 3079 98.955 1 1721 1 chr6B.!!$R1 1720
2 TraesCS6B01G234700 chr1A 238107620 238109345 1725 True 3083 3083 98.957 1 1721 1 chr1A.!!$R1 1720
3 TraesCS6B01G234700 chr1A 238153005 238154730 1725 True 3083 3083 98.957 1 1721 1 chr1A.!!$R2 1720
4 TraesCS6B01G234700 chr7D 579015978 579017700 1722 False 3075 3075 98.897 1 1721 1 chr7D.!!$F1 1720
5 TraesCS6B01G234700 chr5A 16575795 16577520 1725 True 3072 3072 98.841 1 1721 1 chr5A.!!$R1 1720
6 TraesCS6B01G234700 chr5A 16613335 16614230 895 True 1600 1600 98.885 1482 2378 1 chr5A.!!$R2 896
7 TraesCS6B01G234700 chr5A 300057557 300058452 895 False 1578 1578 98.439 1482 2378 1 chr5A.!!$F1 896
8 TraesCS6B01G234700 chrUn 237255712 237257430 1718 True 3064 3064 98.839 1 1720 1 chrUn.!!$R1 1719
9 TraesCS6B01G234700 chr7A 60326885 60328610 1725 True 3061 3061 98.725 1 1721 1 chr7A.!!$R1 1720
10 TraesCS6B01G234700 chr7A 671951080 671951975 895 True 1578 1578 98.439 1482 2378 1 chr7A.!!$R3 896
11 TraesCS6B01G234700 chr7A 120916236 120917129 893 True 1574 1574 98.436 1484 2378 1 chr7A.!!$R2 894
12 TraesCS6B01G234700 chr3B 483372716 483374439 1723 False 3031 3031 98.436 1 1721 1 chr3B.!!$F1 1720
13 TraesCS6B01G234700 chr3B 201626049 201626944 895 True 1583 1583 98.551 1482 2378 1 chr3B.!!$R1 896
14 TraesCS6B01G234700 chr1B 672506427 672508150 1723 True 3020 3020 98.320 1 1721 1 chr1B.!!$R1 1720
15 TraesCS6B01G234700 chr7B 743074882 743075777 895 False 1594 1594 98.774 1482 2378 1 chr7B.!!$F1 896
16 TraesCS6B01G234700 chr7B 743103427 743104322 895 True 1589 1589 98.662 1482 2378 1 chr7B.!!$R1 896
17 TraesCS6B01G234700 chr2A 735181357 735182252 895 False 1594 1594 98.774 1482 2378 1 chr2A.!!$F1 896
18 TraesCS6B01G234700 chr6A 289117363 289118257 894 False 1576 1576 98.438 1484 2378 1 chr6A.!!$F1 894

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
956 961 1.068741 GTGCTTCGGATCGGGAGTAAT 59.931 52.381 10.09 0.0 0.0 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2018 2026 0.240411 GAGCGTAATAGGCGATCCGT 59.76 55.0 0.0 0.0 38.61 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
433 434 2.346244 CGTTAGCGCATCCGTTTTCTTA 59.654 45.455 11.47 0.00 36.67 2.10
956 961 1.068741 GTGCTTCGGATCGGGAGTAAT 59.931 52.381 10.09 0.00 0.00 1.89
1116 1121 0.319986 TATGCCTGCGTGTTTCGACA 60.320 50.000 0.00 0.00 42.86 4.35
1312 1317 4.559862 ATTCGAGGAGTCAAGGATTTGT 57.440 40.909 0.00 0.00 35.73 2.83
1680 1685 6.553100 AGGAAATTGTGGTCCTCAAAACAATA 59.447 34.615 10.30 0.00 40.38 1.90
2018 2026 2.026641 CCTGTCGAAATAGGTACCCGA 58.973 52.381 8.74 7.23 0.00 5.14
2104 2112 0.404040 TCAAAATCGCCCAGGTCCTT 59.596 50.000 0.00 0.00 0.00 3.36
2295 2304 1.608336 TCGGGGGAAAGAAGAGCGA 60.608 57.895 0.00 0.00 0.00 4.93
2337 2346 6.094881 CACTGTTTCCCTAAGTTCAAAAGTGA 59.905 38.462 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
956 961 3.496331 CCCTTTGCCCTTTCTAAAGTGA 58.504 45.455 2.03 0.0 34.20 3.41
1312 1317 2.390696 TCTACGATCCGGAATTCCCAA 58.609 47.619 19.01 7.4 34.14 4.12
2018 2026 0.240411 GAGCGTAATAGGCGATCCGT 59.760 55.000 0.00 0.0 38.61 4.69
2076 2084 1.531058 GGGCGATTTTGATCCGTTTCG 60.531 52.381 0.00 0.0 0.00 3.46
2104 2112 3.198068 GCTTCGCTTGGACATATCTTCA 58.802 45.455 0.00 0.0 0.00 3.02
2295 2304 1.694696 AGTGAAAGAAGCCCTCGTTCT 59.305 47.619 11.52 0.0 41.55 3.01
2337 2346 3.440173 CCATAGACAGCGTTTCCACATTT 59.560 43.478 0.00 0.0 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.