Multiple sequence alignment - TraesCS6B01G231500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G231500 chr6B 100.000 2264 0 0 1 2264 381313994 381311731 0 4181
1 TraesCS6B01G231500 chr5B 98.986 2269 18 2 1 2264 433002513 433000245 0 4058
2 TraesCS6B01G231500 chr5B 98.854 2268 22 1 1 2264 471294933 471292666 0 4041
3 TraesCS6B01G231500 chr5B 98.546 2269 27 3 1 2264 281832853 281830586 0 4002
4 TraesCS6B01G231500 chr5B 98.414 2270 29 4 1 2264 351469616 351467348 0 3986
5 TraesCS6B01G231500 chr7A 98.898 2269 19 3 1 2264 16005011 16007278 0 4047
6 TraesCS6B01G231500 chr2A 98.898 2268 21 1 1 2264 728933672 728935939 0 4047
7 TraesCS6B01G231500 chr7B 98.281 2269 33 3 1 2264 133432653 133430386 0 3969
8 TraesCS6B01G231500 chr7B 98.238 2270 33 4 1 2264 102652612 102654880 0 3964
9 TraesCS6B01G231500 chr4A 98.237 2269 34 3 1 2264 735292695 735294962 0 3964


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G231500 chr6B 381311731 381313994 2263 True 4181 4181 100.000 1 2264 1 chr6B.!!$R1 2263
1 TraesCS6B01G231500 chr5B 433000245 433002513 2268 True 4058 4058 98.986 1 2264 1 chr5B.!!$R3 2263
2 TraesCS6B01G231500 chr5B 471292666 471294933 2267 True 4041 4041 98.854 1 2264 1 chr5B.!!$R4 2263
3 TraesCS6B01G231500 chr5B 281830586 281832853 2267 True 4002 4002 98.546 1 2264 1 chr5B.!!$R1 2263
4 TraesCS6B01G231500 chr5B 351467348 351469616 2268 True 3986 3986 98.414 1 2264 1 chr5B.!!$R2 2263
5 TraesCS6B01G231500 chr7A 16005011 16007278 2267 False 4047 4047 98.898 1 2264 1 chr7A.!!$F1 2263
6 TraesCS6B01G231500 chr2A 728933672 728935939 2267 False 4047 4047 98.898 1 2264 1 chr2A.!!$F1 2263
7 TraesCS6B01G231500 chr7B 133430386 133432653 2267 True 3969 3969 98.281 1 2264 1 chr7B.!!$R1 2263
8 TraesCS6B01G231500 chr7B 102652612 102654880 2268 False 3964 3964 98.238 1 2264 1 chr7B.!!$F1 2263
9 TraesCS6B01G231500 chr4A 735292695 735294962 2267 False 3964 3964 98.237 1 2264 1 chr4A.!!$F1 2263

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
367 369 0.692419 CCTGAGTACCATGGCCCTCT 60.692 60.0 24.19 13.36 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1493 1497 0.53264 TCTTGCTCACGCTTCTTGCA 60.533 50.0 0.0 0.0 43.06 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 2.368439 ACAAGCAAGCAAGTCTTCACA 58.632 42.857 0.00 0.00 31.27 3.58
367 369 0.692419 CCTGAGTACCATGGCCCTCT 60.692 60.000 24.19 13.36 0.00 3.69
1176 1180 1.227999 ACCGCAACAAGTCATGGACG 61.228 55.000 0.00 0.00 37.67 4.79
1493 1497 0.251386 TGAGAAGGAGGCTCGTGAGT 60.251 55.000 10.92 0.00 35.15 3.41
1679 1683 2.720933 CGTCGATGATGAACTGTCGAT 58.279 47.619 0.00 0.00 43.81 3.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
367 369 3.711704 CAGAAGAGGGTCTGGCCTAATAA 59.288 47.826 3.32 0.0 41.21 1.40
1176 1180 4.024302 CACACGAAAAACCTTCTACCTTCC 60.024 45.833 0.00 0.0 0.00 3.46
1493 1497 0.532640 TCTTGCTCACGCTTCTTGCA 60.533 50.000 0.00 0.0 43.06 4.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.