Multiple sequence alignment - TraesCS6B01G227100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G227100 chr6B 100.000 3116 0 0 1 3116 350827202 350830317 0.000000e+00 5755.0
1 TraesCS6B01G227100 chr6B 99.096 774 7 0 1 774 212974174 212973401 0.000000e+00 1391.0
2 TraesCS6B01G227100 chr6B 88.525 61 1 6 2791 2848 247044020 247044077 5.580000e-08 69.4
3 TraesCS6B01G227100 chr6D 97.557 2333 45 6 789 3116 255622926 255620601 0.000000e+00 3982.0
4 TraesCS6B01G227100 chr6A 96.872 2334 55 8 789 3116 328292846 328295167 0.000000e+00 3890.0
5 TraesCS6B01G227100 chr7B 99.354 774 5 0 1 774 3553949 3553176 0.000000e+00 1402.0
6 TraesCS6B01G227100 chr7B 99.606 762 3 0 1 762 457547888 457548649 0.000000e+00 1391.0
7 TraesCS6B01G227100 chr7B 98.969 776 6 1 1 776 748872881 748873654 0.000000e+00 1387.0
8 TraesCS6B01G227100 chr7A 99.738 762 2 0 1 762 19056131 19055370 0.000000e+00 1397.0
9 TraesCS6B01G227100 chr5B 99.226 775 4 2 1 775 711344135 711343363 0.000000e+00 1397.0
10 TraesCS6B01G227100 chr5B 88.235 68 6 2 2792 2858 620528692 620528626 2.580000e-11 80.5
11 TraesCS6B01G227100 chr5B 84.146 82 10 3 2805 2884 52304429 52304509 3.330000e-10 76.8
12 TraesCS6B01G227100 chr3A 99.738 762 2 0 1 762 214136011 214135250 0.000000e+00 1397.0
13 TraesCS6B01G227100 chr5A 99.096 774 5 2 1 774 342244769 342245540 0.000000e+00 1389.0
14 TraesCS6B01G227100 chr5A 81.928 83 12 3 2804 2884 17283696 17283777 2.010000e-07 67.6
15 TraesCS6B01G227100 chr1A 98.968 775 7 1 1 775 520146759 520145986 0.000000e+00 1386.0
16 TraesCS6B01G227100 chr1A 89.706 68 7 0 1832 1899 41367403 41367336 1.540000e-13 87.9
17 TraesCS6B01G227100 chr1D 88.235 68 8 0 1832 1899 41565556 41565489 7.160000e-12 82.4
18 TraesCS6B01G227100 chr4D 81.818 88 12 3 2804 2889 291768528 291768443 1.550000e-08 71.3
19 TraesCS6B01G227100 chr1B 82.500 80 11 3 2807 2884 539945001 539944923 2.010000e-07 67.6
20 TraesCS6B01G227100 chr7D 81.250 80 12 3 2807 2884 16150649 16150571 9.330000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G227100 chr6B 350827202 350830317 3115 False 5755 5755 100.000 1 3116 1 chr6B.!!$F2 3115
1 TraesCS6B01G227100 chr6B 212973401 212974174 773 True 1391 1391 99.096 1 774 1 chr6B.!!$R1 773
2 TraesCS6B01G227100 chr6D 255620601 255622926 2325 True 3982 3982 97.557 789 3116 1 chr6D.!!$R1 2327
3 TraesCS6B01G227100 chr6A 328292846 328295167 2321 False 3890 3890 96.872 789 3116 1 chr6A.!!$F1 2327
4 TraesCS6B01G227100 chr7B 3553176 3553949 773 True 1402 1402 99.354 1 774 1 chr7B.!!$R1 773
5 TraesCS6B01G227100 chr7B 457547888 457548649 761 False 1391 1391 99.606 1 762 1 chr7B.!!$F1 761
6 TraesCS6B01G227100 chr7B 748872881 748873654 773 False 1387 1387 98.969 1 776 1 chr7B.!!$F2 775
7 TraesCS6B01G227100 chr7A 19055370 19056131 761 True 1397 1397 99.738 1 762 1 chr7A.!!$R1 761
8 TraesCS6B01G227100 chr5B 711343363 711344135 772 True 1397 1397 99.226 1 775 1 chr5B.!!$R2 774
9 TraesCS6B01G227100 chr3A 214135250 214136011 761 True 1397 1397 99.738 1 762 1 chr3A.!!$R1 761
10 TraesCS6B01G227100 chr5A 342244769 342245540 771 False 1389 1389 99.096 1 774 1 chr5A.!!$F2 773
11 TraesCS6B01G227100 chr1A 520145986 520146759 773 True 1386 1386 98.968 1 775 1 chr1A.!!$R2 774

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1008 1013 4.0329 CCGTTTATTCACTGAATGGACTCG 59.967 45.833 13.66 10.44 32.46 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2850 2857 1.340088 TGTTTACCGGACTAGTGGCA 58.66 50.0 9.46 0.0 0.0 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1008 1013 4.032900 CCGTTTATTCACTGAATGGACTCG 59.967 45.833 13.66 10.44 32.46 4.18
1029 1034 3.370231 ACCAACCAATTCGCCGGC 61.370 61.111 19.07 19.07 0.00 6.13
1030 1035 4.474846 CCAACCAATTCGCCGGCG 62.475 66.667 42.13 42.13 41.35 6.46
1317 1322 1.153549 CGCCTCCCTCCTTTCTTCG 60.154 63.158 0.00 0.00 0.00 3.79
1350 1355 4.512914 GCCCCATCTGCCACTCCC 62.513 72.222 0.00 0.00 0.00 4.30
1368 1373 2.119832 GCCCCTCCCGCTCCTATA 59.880 66.667 0.00 0.00 0.00 1.31
1383 1388 1.412710 CCTATACAAGAGCTTCCCGCA 59.587 52.381 0.00 0.00 42.61 5.69
2219 2225 6.545666 TCTGAAATAAACTGGTGCAAGAAGAA 59.454 34.615 0.00 0.00 0.00 2.52
2311 2317 6.053650 GTGGTTGAACTCAAGTACCTAGTTT 58.946 40.000 6.56 0.00 36.39 2.66
2440 2447 8.666821 GGGTGAGTTTAGGGGAAGTATAATATT 58.333 37.037 0.00 0.00 0.00 1.28
2473 2480 4.447054 CCATATGCACTCGTTCTTGATCTC 59.553 45.833 0.00 0.00 0.00 2.75
2850 2857 4.631813 GCAACGGAGAAAAGAGTATCACAT 59.368 41.667 0.00 0.00 37.82 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
621 622 3.267483 ACGAGCGTAAACATAAAGCCAT 58.733 40.909 0.00 0.0 0.00 4.40
842 843 6.208599 TCCTGCATTTTCTTCCGATAACTTTT 59.791 34.615 0.00 0.0 0.00 2.27
911 916 2.223135 GCGATTCTTCTTGCTTACAGGC 60.223 50.000 0.00 0.0 0.00 4.85
918 923 1.277557 AGGTCTGCGATTCTTCTTGCT 59.722 47.619 0.00 0.0 0.00 3.91
1008 1013 1.584495 GGCGAATTGGTTGGTGGTC 59.416 57.895 0.00 0.0 0.00 4.02
1317 1322 2.045242 GCGGGAAAAGGGAGGGAC 60.045 66.667 0.00 0.0 0.00 4.46
1350 1355 3.881019 TATAGGAGCGGGAGGGGCG 62.881 68.421 0.00 0.0 35.00 6.13
1601 1606 3.507924 GCACATCGCGGCCATCAA 61.508 61.111 6.13 0.0 0.00 2.57
2169 2174 9.841295 GATACTATAAGTTTCAATTGTACCCCA 57.159 33.333 5.13 0.0 0.00 4.96
2440 2447 3.066760 CGAGTGCATATGGACACAGACTA 59.933 47.826 26.61 0.0 39.30 2.59
2813 2820 2.669910 TTGCAACGCACGGGCATA 60.670 55.556 11.77 0.0 38.71 3.14
2840 2847 3.551046 CGGACTAGTGGCATGTGATACTC 60.551 52.174 0.00 0.0 0.00 2.59
2850 2857 1.340088 TGTTTACCGGACTAGTGGCA 58.660 50.000 9.46 0.0 0.00 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.