Multiple sequence alignment - TraesCS6B01G225300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G225300 chr6B 100.000 2270 0 0 1 2270 346415408 346413139 0.000000e+00 4193
1 TraesCS6B01G225300 chr5B 99.075 2271 20 1 1 2270 239324174 239321904 0.000000e+00 4076
2 TraesCS6B01G225300 chr5A 98.899 2271 24 1 1 2270 320270641 320272911 0.000000e+00 4054
3 TraesCS6B01G225300 chr4B 98.327 2272 36 2 1 2270 92551157 92553428 0.000000e+00 3984
4 TraesCS6B01G225300 chr1B 98.066 1810 32 1 461 2270 269072707 269070901 0.000000e+00 3145
5 TraesCS6B01G225300 chr7D 87.148 2272 258 18 10 2270 580112421 580110173 0.000000e+00 2547
6 TraesCS6B01G225300 chr7B 98.719 1327 16 1 1 1326 516451637 516452963 0.000000e+00 2355
7 TraesCS6B01G225300 chr7B 92.439 1349 98 3 922 2270 27982672 27984016 0.000000e+00 1923
8 TraesCS6B01G225300 chr7B 99.261 947 7 0 1324 2270 516455488 516456434 0.000000e+00 1711
9 TraesCS6B01G225300 chr1A 85.151 2283 298 19 1 2270 94243745 94241491 0.000000e+00 2300
10 TraesCS6B01G225300 chr2A 97.887 1136 20 1 327 1458 608935391 608934256 0.000000e+00 1962
11 TraesCS6B01G225300 chr2A 98.238 227 4 0 1 227 608936382 608936156 4.540000e-107 398
12 TraesCS6B01G225300 chr3A 87.317 1569 183 12 710 2270 711443773 711442213 0.000000e+00 1781


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G225300 chr6B 346413139 346415408 2269 True 4193 4193 100.0000 1 2270 1 chr6B.!!$R1 2269
1 TraesCS6B01G225300 chr5B 239321904 239324174 2270 True 4076 4076 99.0750 1 2270 1 chr5B.!!$R1 2269
2 TraesCS6B01G225300 chr5A 320270641 320272911 2270 False 4054 4054 98.8990 1 2270 1 chr5A.!!$F1 2269
3 TraesCS6B01G225300 chr4B 92551157 92553428 2271 False 3984 3984 98.3270 1 2270 1 chr4B.!!$F1 2269
4 TraesCS6B01G225300 chr1B 269070901 269072707 1806 True 3145 3145 98.0660 461 2270 1 chr1B.!!$R1 1809
5 TraesCS6B01G225300 chr7D 580110173 580112421 2248 True 2547 2547 87.1480 10 2270 1 chr7D.!!$R1 2260
6 TraesCS6B01G225300 chr7B 516451637 516456434 4797 False 2033 2355 98.9900 1 2270 2 chr7B.!!$F2 2269
7 TraesCS6B01G225300 chr7B 27982672 27984016 1344 False 1923 1923 92.4390 922 2270 1 chr7B.!!$F1 1348
8 TraesCS6B01G225300 chr1A 94241491 94243745 2254 True 2300 2300 85.1510 1 2270 1 chr1A.!!$R1 2269
9 TraesCS6B01G225300 chr2A 608934256 608936382 2126 True 1180 1962 98.0625 1 1458 2 chr2A.!!$R1 1457
10 TraesCS6B01G225300 chr3A 711442213 711443773 1560 True 1781 1781 87.3170 710 2270 1 chr3A.!!$R1 1560

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
613 1327 2.50161 GGTGGATCGCTCCCTGTC 59.498 66.667 2.2 0.0 41.29 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2198 5454 1.002624 GGGGCAGTGATCGGACAAA 60.003 57.895 0.0 0.0 0.0 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
613 1327 2.501610 GGTGGATCGCTCCCTGTC 59.498 66.667 2.20 0.00 41.29 3.51
672 1392 4.681978 GCGACGCCAACACCTCCT 62.682 66.667 9.14 0.00 0.00 3.69
1070 1790 0.244721 GTGGATGAAGGCCAACAAGC 59.755 55.000 5.01 1.39 37.12 4.01
1409 4656 1.455383 CCTTGGCGAGGCTTTTGTGT 61.455 55.000 8.12 0.00 39.09 3.72
1778 5032 2.601763 GGATAACGATGTTGTGGACGTC 59.398 50.000 7.13 7.13 40.27 4.34
1933 5187 0.610785 GGCGAAAAACCTCCCCATGA 60.611 55.000 0.00 0.00 0.00 3.07
2132 5387 1.066787 ACCTTAAGCAAGCTCGACTCC 60.067 52.381 0.00 0.00 0.00 3.85
2198 5454 1.296755 TACACGCGCTCTCGTCTTCT 61.297 55.000 5.73 0.00 41.21 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 206 4.168291 CAGGAGGAAGGGCGCTCC 62.168 72.222 2.00 4.47 35.43 4.70
613 1327 2.664851 TCGTTGCTTGGTGCCGAG 60.665 61.111 1.07 1.07 42.00 4.63
1070 1790 1.271543 TGTCAATGGCTTCCTCTGTGG 60.272 52.381 0.00 0.00 37.10 4.17
1409 4656 5.526115 ACTGAAACGAGACAAACTAATCGA 58.474 37.500 0.00 0.00 38.50 3.59
1650 4904 2.029290 TGAAAGGGTCGACAAGCTCTAC 60.029 50.000 18.91 0.00 0.00 2.59
1933 5187 2.486191 CCAGAGACAAGCCACTTTGAGT 60.486 50.000 0.00 0.00 0.00 3.41
2198 5454 1.002624 GGGGCAGTGATCGGACAAA 60.003 57.895 0.00 0.00 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.