Multiple sequence alignment - TraesCS6B01G219000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G219000 chr6B 100.000 2313 0 0 1 2313 307014538 307012226 0 4272
1 TraesCS6B01G219000 chrUn 98.660 2314 29 2 1 2313 170995032 170992720 0 4100
2 TraesCS6B01G219000 chr7B 98.617 2314 31 1 1 2313 644446412 644448725 0 4095
3 TraesCS6B01G219000 chr7B 98.617 2314 31 1 1 2313 743095875 743098188 0 4095
4 TraesCS6B01G219000 chr7B 97.450 2314 56 3 1 2313 54063139 54065450 0 3943
5 TraesCS6B01G219000 chr4B 97.882 2314 44 5 1 2313 623334089 623331780 0 3997
6 TraesCS6B01G219000 chr1B 97.839 2314 48 2 1 2313 672527983 672525671 0 3995


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G219000 chr6B 307012226 307014538 2312 True 4272 4272 100.000 1 2313 1 chr6B.!!$R1 2312
1 TraesCS6B01G219000 chrUn 170992720 170995032 2312 True 4100 4100 98.660 1 2313 1 chrUn.!!$R1 2312
2 TraesCS6B01G219000 chr7B 644446412 644448725 2313 False 4095 4095 98.617 1 2313 1 chr7B.!!$F2 2312
3 TraesCS6B01G219000 chr7B 743095875 743098188 2313 False 4095 4095 98.617 1 2313 1 chr7B.!!$F3 2312
4 TraesCS6B01G219000 chr7B 54063139 54065450 2311 False 3943 3943 97.450 1 2313 1 chr7B.!!$F1 2312
5 TraesCS6B01G219000 chr4B 623331780 623334089 2309 True 3997 3997 97.882 1 2313 1 chr4B.!!$R1 2312
6 TraesCS6B01G219000 chr1B 672525671 672527983 2312 True 3995 3995 97.839 1 2313 1 chr1B.!!$R1 2312

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
651 652 0.735978 TCAAGTGTACGGCATCTGCG 60.736 55.0 0.0 0.0 43.26 5.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2055 2058 1.945394 GGCATGATCGCTGATTTGACT 59.055 47.619 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 7.986889 ACAAGCAAAAATGGTTGAAAAGTCTAT 59.013 29.630 22.88 0.0 46.59 1.98
520 521 1.328279 TTCGTCTTCAGTGCTCTCCA 58.672 50.000 0.00 0.0 0.00 3.86
651 652 0.735978 TCAAGTGTACGGCATCTGCG 60.736 55.000 0.00 0.0 43.26 5.18
737 738 1.071071 GGGTATAGGTATGGCGTGCAA 59.929 52.381 0.00 0.0 0.00 4.08
788 789 2.036862 ACTACCGAAGCGAAGAAAAGGT 59.963 45.455 0.00 0.0 0.00 3.50
969 970 3.026847 CCCCATAAGGCCCCACCA 61.027 66.667 0.00 0.0 43.14 4.17
1030 1031 0.036388 CGTCTTAGCCTTGCCTTCCA 60.036 55.000 0.00 0.0 0.00 3.53
1053 1054 1.267574 ATCGCTCCCACACCTGTCAT 61.268 55.000 0.00 0.0 0.00 3.06
2055 2058 2.993008 GCTCATCTGGTCTGCCCA 59.007 61.111 0.00 0.0 42.51 5.36
2254 2258 3.636764 AGGAAATCGCAATCCAATTACCC 59.363 43.478 3.56 0.0 38.23 3.69
2268 2272 4.752101 CCAATTACCCTGAGAGCGAATTAG 59.248 45.833 0.00 0.0 0.00 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 7.887381 TGGTTGTTTTACTCTCTTTCAAACAA 58.113 30.769 4.76 4.76 42.29 2.83
166 167 1.603678 GGTTTACACGACTTCAGGCGA 60.604 52.381 9.59 0.00 0.00 5.54
520 521 1.454295 AAACCTTCCCGCACGGTTT 60.454 52.632 8.49 0.00 43.98 3.27
737 738 1.513087 AAATCCAAGGGAGGCTGGCT 61.513 55.000 2.24 2.24 34.05 4.75
944 945 2.395353 GCCTTATGGGGAAGGGCCT 61.395 63.158 0.00 0.00 45.40 5.19
1030 1031 1.613630 AGGTGTGGGAGCGATCCTT 60.614 57.895 20.86 0.00 0.00 3.36
1053 1054 1.945354 GAGGAGGCCGATCACGAACA 61.945 60.000 0.00 0.00 42.66 3.18
1389 1391 3.112580 CCACGTGCGTTTCATTTTCTTT 58.887 40.909 10.91 0.00 0.00 2.52
1475 1477 7.049799 ACTTATTGTCTTTTTGCCTTTGCTA 57.950 32.000 0.00 0.00 38.71 3.49
2055 2058 1.945394 GGCATGATCGCTGATTTGACT 59.055 47.619 0.00 0.00 0.00 3.41
2212 2216 6.511017 TCCTCTGGATTCAATCTCAATGAT 57.489 37.500 0.00 0.00 36.89 2.45
2254 2258 3.181492 TGACTCTGCTAATTCGCTCTCAG 60.181 47.826 3.41 0.00 0.00 3.35
2268 2272 4.757149 ACCATTTAGTTGAACTGACTCTGC 59.243 41.667 8.33 0.00 0.00 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.