Multiple sequence alignment - TraesCS6B01G218900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G218900 chr6B 100.000 2255 0 0 1 2255 306997806 306995552 0 4165
1 TraesCS6B01G218900 chr1D 99.024 2255 21 1 1 2255 141314951 141312698 0 4041
2 TraesCS6B01G218900 chr7B 98.936 2256 23 1 1 2255 644465627 644467882 0 4032
3 TraesCS6B01G218900 chr3A 98.847 2255 26 0 1 2255 633109438 633111692 0 4021
4 TraesCS6B01G218900 chr7A 98.803 2255 27 0 1 2255 60150103 60147849 0 4015
5 TraesCS6B01G218900 chr7A 97.958 2253 45 1 3 2255 46399060 46396809 0 3904
6 TraesCS6B01G218900 chr1B 98.581 2255 32 0 1 2255 672477345 672479599 0 3988
7 TraesCS6B01G218900 chr1B 98.493 2256 32 2 1 2255 638702482 638700228 0 3976
8 TraesCS6B01G218900 chr4B 98.537 2255 32 1 1 2255 209079333 209077080 0 3980
9 TraesCS6B01G218900 chr2B 98.050 2256 38 3 1 2255 391114652 391112402 0 3917


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G218900 chr6B 306995552 306997806 2254 True 4165 4165 100.000 1 2255 1 chr6B.!!$R1 2254
1 TraesCS6B01G218900 chr1D 141312698 141314951 2253 True 4041 4041 99.024 1 2255 1 chr1D.!!$R1 2254
2 TraesCS6B01G218900 chr7B 644465627 644467882 2255 False 4032 4032 98.936 1 2255 1 chr7B.!!$F1 2254
3 TraesCS6B01G218900 chr3A 633109438 633111692 2254 False 4021 4021 98.847 1 2255 1 chr3A.!!$F1 2254
4 TraesCS6B01G218900 chr7A 60147849 60150103 2254 True 4015 4015 98.803 1 2255 1 chr7A.!!$R2 2254
5 TraesCS6B01G218900 chr7A 46396809 46399060 2251 True 3904 3904 97.958 3 2255 1 chr7A.!!$R1 2252
6 TraesCS6B01G218900 chr1B 672477345 672479599 2254 False 3988 3988 98.581 1 2255 1 chr1B.!!$F1 2254
7 TraesCS6B01G218900 chr1B 638700228 638702482 2254 True 3976 3976 98.493 1 2255 1 chr1B.!!$R1 2254
8 TraesCS6B01G218900 chr4B 209077080 209079333 2253 True 3980 3980 98.537 1 2255 1 chr4B.!!$R1 2254
9 TraesCS6B01G218900 chr2B 391112402 391114652 2250 True 3917 3917 98.050 1 2255 1 chr2B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
799 800 2.094234 GTCTATTGTGCCCGGCAAAAAT 60.094 45.455 19.14 19.72 39.34 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2173 2178 1.697432 TGTGTCTGGAAACTCGGGATT 59.303 47.619 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 5.071370 TCGTGGACCTATCTATCTTCTTCC 58.929 45.833 0.00 0.00 0.00 3.46
591 592 7.389607 GCTTTGTACTTGAAATTAGTAGTCCCA 59.610 37.037 0.00 0.00 0.00 4.37
720 721 5.578336 TCAGATCATTCAACTAAAGCTGTCG 59.422 40.000 0.00 0.00 0.00 4.35
799 800 2.094234 GTCTATTGTGCCCGGCAAAAAT 60.094 45.455 19.14 19.72 39.34 1.82
878 880 8.574309 AGTATATTTCCCTTCTCCATTCTCTT 57.426 34.615 0.00 0.00 0.00 2.85
914 916 4.475028 CGCTTGTGTGAATTTCATTGCTA 58.525 39.130 1.78 0.00 0.00 3.49
1241 1243 1.175983 TTTTGGGCCGCTGTTACCAG 61.176 55.000 0.00 0.00 41.91 4.00
1298 1300 8.383175 ACTTAGTTGTTTCCATTTCCTCATCTA 58.617 33.333 0.00 0.00 0.00 1.98
1345 1347 6.197168 TGGCTCAAATCCCTTTTTCATATCT 58.803 36.000 0.00 0.00 0.00 1.98
1484 1486 4.202577 TGAAAGGTCAGAGTCAGTCTCCTA 60.203 45.833 0.00 0.00 43.71 2.94
1860 1862 3.496692 CCTTCACTGAACTGATTCACCCA 60.497 47.826 0.00 0.00 40.01 4.51
2110 2115 2.034939 TCGAAGTTTAGACCGCTCACAA 59.965 45.455 0.00 0.00 0.00 3.33
2173 2178 4.781775 ATGGTACCCGAATCCATTTACA 57.218 40.909 10.07 0.00 38.61 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 8.753497 AATAGCAAACCCCTATCTCTTAAAAG 57.247 34.615 0.00 0.00 0.00 2.27
914 916 3.249189 AGCACACACGGGACCCAT 61.249 61.111 12.15 0.00 0.00 4.00
1241 1243 5.077564 AGGTTTAGGTTCAGGAAATGGAAC 58.922 41.667 0.00 0.00 42.00 3.62
1298 1300 6.494491 CCAGAAGAAGATGAGGATCTATCACT 59.506 42.308 3.71 2.15 38.03 3.41
1345 1347 1.117150 CGTACCTAAAGCCTGCCCTA 58.883 55.000 0.00 0.00 0.00 3.53
1484 1486 7.937649 ACTGCTAAACGACCTAAAAGAAAAAT 58.062 30.769 0.00 0.00 0.00 1.82
1760 1762 2.430921 AGTTCGCTCGCGGAGTTG 60.431 61.111 6.13 0.32 40.25 3.16
2173 2178 1.697432 TGTGTCTGGAAACTCGGGATT 59.303 47.619 0.00 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.