Multiple sequence alignment - TraesCS6B01G218800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G218800 chr6B 100.000 3215 0 0 1 3215 306995907 306992693 0 5938
1 TraesCS6B01G218800 chr4D 98.881 3216 32 2 1 3215 123299973 123303185 0 5736
2 TraesCS6B01G218800 chr7D 98.601 3217 41 3 1 3215 203515559 203518773 0 5688
3 TraesCS6B01G218800 chr3A 98.227 3215 51 3 1 3215 633111337 633114545 0 5616
4 TraesCS6B01G218800 chr1B 98.164 3214 55 4 4 3215 638700580 638697369 0 5605
5 TraesCS6B01G218800 chr1B 97.698 3215 70 1 1 3215 672479244 672482454 0 5524
6 TraesCS6B01G218800 chr4B 97.637 3216 71 2 1 3215 209077435 209074224 0 5513
7 TraesCS6B01G218800 chr7A 97.544 3216 78 1 1 3215 211275128 211271913 0 5500
8 TraesCS6B01G218800 chr7A 97.170 3215 81 6 1 3215 575288572 575291776 0 5424
9 TraesCS6B01G218800 chr5B 96.297 3214 115 2 1 3214 455628871 455632080 0 5273


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G218800 chr6B 306992693 306995907 3214 True 5938 5938 100.000 1 3215 1 chr6B.!!$R1 3214
1 TraesCS6B01G218800 chr4D 123299973 123303185 3212 False 5736 5736 98.881 1 3215 1 chr4D.!!$F1 3214
2 TraesCS6B01G218800 chr7D 203515559 203518773 3214 False 5688 5688 98.601 1 3215 1 chr7D.!!$F1 3214
3 TraesCS6B01G218800 chr3A 633111337 633114545 3208 False 5616 5616 98.227 1 3215 1 chr3A.!!$F1 3214
4 TraesCS6B01G218800 chr1B 638697369 638700580 3211 True 5605 5605 98.164 4 3215 1 chr1B.!!$R1 3211
5 TraesCS6B01G218800 chr1B 672479244 672482454 3210 False 5524 5524 97.698 1 3215 1 chr1B.!!$F1 3214
6 TraesCS6B01G218800 chr4B 209074224 209077435 3211 True 5513 5513 97.637 1 3215 1 chr4B.!!$R1 3214
7 TraesCS6B01G218800 chr7A 211271913 211275128 3215 True 5500 5500 97.544 1 3215 1 chr7A.!!$R1 3214
8 TraesCS6B01G218800 chr7A 575288572 575291776 3204 False 5424 5424 97.170 1 3215 1 chr7A.!!$F1 3214
9 TraesCS6B01G218800 chr5B 455628871 455632080 3209 False 5273 5273 96.297 1 3214 1 chr5B.!!$F1 3213

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
211 213 2.034939 TCGAAGTTTAGACCGCTCACAA 59.965 45.455 0.00 0.0 0.0 3.33 F
1047 1054 0.107643 GAAGGGGCCTGCTGATAGAC 59.892 60.000 0.84 0.0 0.0 2.59 F
1673 1680 0.606401 CCATCAGGCGTTCAACAGGT 60.606 55.000 0.00 0.0 0.0 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1673 1680 0.668535 CATGCCCGATCGTGAGACTA 59.331 55.000 15.09 0.0 46.97 2.59 R
1989 1996 3.055094 AGCGGATCTGGTAGTTGACAATT 60.055 43.478 3.92 0.0 0.00 2.32 R
2503 2512 3.622455 GCCATTGTGGGTAGAAGCTAGTT 60.622 47.826 0.00 0.0 38.19 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 213 2.034939 TCGAAGTTTAGACCGCTCACAA 59.965 45.455 0.00 0.00 0.00 3.33
274 276 4.781775 ATGGTACCCGAATCCATTTACA 57.218 40.909 10.07 0.00 38.61 2.41
439 441 5.980698 TCGATTCATCTCAATCTTGAAGC 57.019 39.130 0.00 0.00 36.64 3.86
493 495 3.020984 ACTCAGAAAAAGTTTTCCGCCA 58.979 40.909 11.90 0.00 45.84 5.69
883 890 3.407967 CCCCTTCAGCGGCCCTAA 61.408 66.667 0.00 0.00 0.00 2.69
1047 1054 0.107643 GAAGGGGCCTGCTGATAGAC 59.892 60.000 0.84 0.00 0.00 2.59
1408 1415 6.932960 GGTAAAGCACCGTATCCATATAACTT 59.067 38.462 0.00 0.00 37.63 2.66
1494 1501 0.616111 AGCTGACGAAGGGGATGAGT 60.616 55.000 0.00 0.00 0.00 3.41
1601 1608 1.003839 GGACCGTCAAGCACATCCA 60.004 57.895 0.00 0.00 32.22 3.41
1673 1680 0.606401 CCATCAGGCGTTCAACAGGT 60.606 55.000 0.00 0.00 0.00 4.00
1809 1816 3.181482 CCATACAGATAGAGGCGCCTATG 60.181 52.174 33.14 25.68 30.03 2.23
1933 1940 3.636929 AATTGGTCCGCGGGCATCA 62.637 57.895 33.48 19.04 0.00 3.07
1989 1996 3.207778 CAACCTTTACCAAGTCCGAACA 58.792 45.455 0.00 0.00 0.00 3.18
2055 2062 1.001487 CACAAGCACAAATCTTCGGCA 60.001 47.619 0.00 0.00 0.00 5.69
2503 2512 3.052082 GCTGCTTCGCTTCTGGCA 61.052 61.111 0.00 0.00 41.91 4.92
2699 2708 1.074471 ACCACCTATCAGGCCCGAT 60.074 57.895 6.71 6.71 39.63 4.18
3078 3087 1.818674 GTCGTTGGGGATTCATTGCTT 59.181 47.619 0.00 0.00 0.00 3.91
3086 3095 2.231964 GGGATTCATTGCTTGTTCTGCA 59.768 45.455 0.00 0.00 38.80 4.41
3126 3135 5.221945 GCCAGCCTAATTTCTAGAATAGGGT 60.222 44.000 22.73 22.73 39.78 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
274 276 1.697432 TGTGTCTGGAAACTCGGGATT 59.303 47.619 0.00 0.00 0.00 3.01
439 441 3.775202 ACTTGGAATCGTCGATCTCTTG 58.225 45.455 8.45 2.50 0.00 3.02
493 495 1.378250 CACCCCCTACGAGTCGTCT 60.378 63.158 23.66 0.21 41.54 4.18
610 612 4.894784 ACAAGAGGAATTTCGTGCTTCTA 58.105 39.130 0.00 0.00 30.95 2.10
648 650 7.565323 ACGACGACCTATTCTTAATAGAACT 57.435 36.000 0.00 0.00 42.91 3.01
883 890 0.608308 GGCTTGTTAAGGAAGGCGGT 60.608 55.000 5.30 0.00 36.40 5.68
963 970 7.631717 ATTAAAGCCTTCTCTACCATTGAAC 57.368 36.000 0.00 0.00 0.00 3.18
1408 1415 3.075005 GGAGCGTAGGTGGCAGGA 61.075 66.667 0.00 0.00 39.88 3.86
1494 1501 1.353358 TCCAGTAGACGACCTCTTCCA 59.647 52.381 0.00 0.00 0.00 3.53
1601 1608 0.761802 GATCCCCCTCGATCTTTGCT 59.238 55.000 0.00 0.00 36.51 3.91
1673 1680 0.668535 CATGCCCGATCGTGAGACTA 59.331 55.000 15.09 0.00 46.97 2.59
1809 1816 5.472320 GAAGCCTTCGGAGTATCTTTTTC 57.528 43.478 0.00 0.00 33.73 2.29
1933 1940 4.506937 AGTAGGACAGAGGACTTATCGT 57.493 45.455 0.00 0.00 0.00 3.73
1989 1996 3.055094 AGCGGATCTGGTAGTTGACAATT 60.055 43.478 3.92 0.00 0.00 2.32
2055 2062 6.788957 TGGGGTACTTTAGGATTATATTCCGT 59.211 38.462 7.80 3.51 40.94 4.69
2503 2512 3.622455 GCCATTGTGGGTAGAAGCTAGTT 60.622 47.826 0.00 0.00 38.19 2.24
2976 2985 4.717877 CACATACATTAAGGGAGCCATCA 58.282 43.478 0.00 0.00 0.00 3.07
3078 3087 6.529125 GCTACGTTACTTATAACTGCAGAACA 59.471 38.462 23.35 4.81 38.89 3.18
3086 3095 4.648307 AGGCTGGCTACGTTACTTATAACT 59.352 41.667 0.13 0.00 38.89 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.