Multiple sequence alignment - TraesCS6B01G213400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G213400 chr6B 100.000 2450 0 0 1 2450 288280925 288283374 0 4525
1 TraesCS6B01G213400 chr5B 90.542 2474 201 14 1 2450 412677274 412674810 0 3241
2 TraesCS6B01G213400 chr5B 88.547 2471 224 33 1 2450 364452058 364449626 0 2940
3 TraesCS6B01G213400 chr5B 96.396 1526 54 1 1 1526 373340473 373341997 0 2512
4 TraesCS6B01G213400 chr3B 90.614 2344 197 15 1 2339 453571607 453569282 0 3088
5 TraesCS6B01G213400 chr3B 90.018 1653 142 16 804 2450 528817743 528816108 0 2117
6 TraesCS6B01G213400 chr4B 90.383 2350 205 17 1 2344 169745630 169747964 0 3068
7 TraesCS6B01G213400 chr4B 89.133 1684 161 17 774 2450 338721516 338719848 0 2076
8 TraesCS6B01G213400 chr2B 89.420 2363 231 16 1 2358 399402308 399399960 0 2961
9 TraesCS6B01G213400 chr2B 89.880 2243 187 28 1 2233 545612022 545609810 0 2848
10 TraesCS6B01G213400 chr7B 97.315 1527 40 1 1 1526 360407655 360406129 0 2591
11 TraesCS6B01G213400 chr7B 96.401 1528 51 3 1 1526 456122105 456123630 0 2514
12 TraesCS6B01G213400 chr1B 91.905 1680 118 13 774 2450 593271483 593269819 0 2333


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G213400 chr6B 288280925 288283374 2449 False 4525 4525 100.000 1 2450 1 chr6B.!!$F1 2449
1 TraesCS6B01G213400 chr5B 412674810 412677274 2464 True 3241 3241 90.542 1 2450 1 chr5B.!!$R2 2449
2 TraesCS6B01G213400 chr5B 364449626 364452058 2432 True 2940 2940 88.547 1 2450 1 chr5B.!!$R1 2449
3 TraesCS6B01G213400 chr5B 373340473 373341997 1524 False 2512 2512 96.396 1 1526 1 chr5B.!!$F1 1525
4 TraesCS6B01G213400 chr3B 453569282 453571607 2325 True 3088 3088 90.614 1 2339 1 chr3B.!!$R1 2338
5 TraesCS6B01G213400 chr3B 528816108 528817743 1635 True 2117 2117 90.018 804 2450 1 chr3B.!!$R2 1646
6 TraesCS6B01G213400 chr4B 169745630 169747964 2334 False 3068 3068 90.383 1 2344 1 chr4B.!!$F1 2343
7 TraesCS6B01G213400 chr4B 338719848 338721516 1668 True 2076 2076 89.133 774 2450 1 chr4B.!!$R1 1676
8 TraesCS6B01G213400 chr2B 399399960 399402308 2348 True 2961 2961 89.420 1 2358 1 chr2B.!!$R1 2357
9 TraesCS6B01G213400 chr2B 545609810 545612022 2212 True 2848 2848 89.880 1 2233 1 chr2B.!!$R2 2232
10 TraesCS6B01G213400 chr7B 360406129 360407655 1526 True 2591 2591 97.315 1 1526 1 chr7B.!!$R1 1525
11 TraesCS6B01G213400 chr7B 456122105 456123630 1525 False 2514 2514 96.401 1 1526 1 chr7B.!!$F1 1525
12 TraesCS6B01G213400 chr1B 593269819 593271483 1664 True 2333 2333 91.905 774 2450 1 chr1B.!!$R1 1676

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
560 583 2.062519 GCTTGGTCTCGAGTTCACTTC 58.937 52.381 13.13 1.0 0.0 3.01 F
1023 1049 4.202441 TGCTTCCTTATGAGATCTTTGCC 58.798 43.478 0.00 0.0 0.0 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1391 1417 0.391597 GTCACCTCGAACCTGGTCAA 59.608 55.00 0.00 0.00 33.75 3.18 R
2339 2379 9.758651 GGTTGAACCACTTATTAAATTTGAAGT 57.241 29.63 9.98 5.19 38.42 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 3.535280 GGATAGGCCTAGCTCTTATGC 57.465 52.381 26.40 6.58 0.00 3.14
164 165 5.316167 TCCTACATGCCATATTTGTGGATC 58.684 41.667 0.00 0.00 42.02 3.36
432 434 6.210385 CAGCTCCTACTCATATACCTCAACAT 59.790 42.308 0.00 0.00 0.00 2.71
560 583 2.062519 GCTTGGTCTCGAGTTCACTTC 58.937 52.381 13.13 1.00 0.00 3.01
945 971 4.647424 TGAAGAACCAGAAACGCATTTT 57.353 36.364 0.00 0.00 0.00 1.82
1023 1049 4.202441 TGCTTCCTTATGAGATCTTTGCC 58.798 43.478 0.00 0.00 0.00 4.52
1032 1058 4.465632 TGAGATCTTTGCCGCTACTTTA 57.534 40.909 0.00 0.00 0.00 1.85
1391 1417 2.984562 TGTGCACGATCCATTACATGT 58.015 42.857 13.13 2.69 0.00 3.21
1478 1504 2.351276 GGGGCACACACGAGGAAT 59.649 61.111 0.00 0.00 0.00 3.01
1536 1565 2.194859 AGGAGAGGAGTCACAATGCAT 58.805 47.619 0.00 0.00 0.00 3.96
1560 1589 3.137360 AGGAAGCAAAGGAGAAGAGTTGT 59.863 43.478 0.00 0.00 0.00 3.32
1769 1800 3.058639 GTGAAGTGAGTGTTGAATGCCTC 60.059 47.826 0.00 0.00 0.00 4.70
1848 1880 3.616956 TGAGTGCTCAAATCCCTAGTG 57.383 47.619 0.00 0.00 36.53 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
164 165 2.124570 CGGGTGAATGGCCCTGAG 60.125 66.667 0.00 0.00 43.92 3.35
560 583 0.103026 TGGATCATCTTCGGCACTCG 59.897 55.000 0.00 0.00 40.90 4.18
945 971 1.040646 GCTCCTGTATGACGATGGGA 58.959 55.000 0.00 0.00 0.00 4.37
1023 1049 7.528481 TGGTATAACACAATGTAAAGTAGCG 57.472 36.000 0.00 0.00 0.00 4.26
1032 1058 9.189156 AGCTTAATTGATGGTATAACACAATGT 57.811 29.630 15.02 10.12 32.66 2.71
1185 1211 7.700322 TTTATCATTAAGCTCAAGACTAGCG 57.300 36.000 0.00 0.00 44.87 4.26
1391 1417 0.391597 GTCACCTCGAACCTGGTCAA 59.608 55.000 0.00 0.00 33.75 3.18
1478 1504 2.964310 GCCTGCTCCAGCTTCTCCA 61.964 63.158 0.00 0.00 42.66 3.86
1536 1565 2.975489 ACTCTTCTCCTTTGCTTCCTCA 59.025 45.455 0.00 0.00 0.00 3.86
1560 1589 3.593096 TCGCTCGACACTCTCTAAACTA 58.407 45.455 0.00 0.00 0.00 2.24
1769 1800 7.594714 AGCATTATGTAGATCACTAGGTTACG 58.405 38.462 0.00 0.00 0.00 3.18
2339 2379 9.758651 GGTTGAACCACTTATTAAATTTGAAGT 57.241 29.630 9.98 5.19 38.42 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.