Multiple sequence alignment - TraesCS6B01G208300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G208300 chr6B 100.000 3602 0 0 896 4497 267504201 267507802 0.000000e+00 6652.0
1 TraesCS6B01G208300 chr6B 99.280 3613 15 1 896 4497 267325763 267329375 0.000000e+00 6517.0
2 TraesCS6B01G208300 chr6B 100.000 742 0 0 1 742 267503306 267504047 0.000000e+00 1371.0
3 TraesCS6B01G208300 chr6B 99.730 742 2 0 1 742 267324960 267325701 0.000000e+00 1360.0
4 TraesCS6B01G208300 chr6B 84.722 504 72 5 1001 1500 267018904 267019406 2.420000e-137 499.0
5 TraesCS6B01G208300 chr6B 84.325 504 73 6 1001 1500 270583869 270584370 5.230000e-134 488.0
6 TraesCS6B01G208300 chr6B 84.127 504 75 5 1001 1500 270468197 270468699 2.430000e-132 483.0
7 TraesCS6B01G208300 chr6B 84.127 504 75 5 1001 1500 270734186 270734688 2.430000e-132 483.0
8 TraesCS6B01G208300 chr6B 76.826 876 149 34 2369 3205 270469605 270470465 1.150000e-120 444.0
9 TraesCS6B01G208300 chr6B 76.739 877 148 36 2369 3205 270735594 270736454 5.340000e-119 438.0
10 TraesCS6B01G208300 chr6B 76.484 876 152 34 2369 3205 270585270 270586130 1.160000e-115 427.0
11 TraesCS6B01G208300 chr6B 94.898 196 5 1 4307 4497 293100077 293099882 7.310000e-78 302.0
12 TraesCS6B01G208300 chr6B 97.701 174 4 0 4303 4476 114122448 114122275 2.630000e-77 300.0
13 TraesCS6B01G208300 chr6B 80.918 414 47 14 1 385 528679651 528680061 9.460000e-77 298.0
14 TraesCS6B01G208300 chr6B 87.550 249 14 9 17 248 89441092 89441340 5.730000e-69 272.0
15 TraesCS6B01G208300 chr6B 78.795 415 74 8 2793 3205 270647197 270647599 2.670000e-67 267.0
16 TraesCS6B01G208300 chr6B 87.293 181 18 5 2675 2851 267021595 267021774 7.630000e-48 202.0
17 TraesCS6B01G208300 chr6B 94.531 128 6 1 258 384 89441378 89441505 3.550000e-46 196.0
18 TraesCS6B01G208300 chr6B 90.476 105 8 2 3915 4019 560797956 560797854 2.180000e-28 137.0
19 TraesCS6B01G208300 chr6B 90.476 63 3 1 929 991 539620903 539620844 3.730000e-11 80.5
20 TraesCS6B01G208300 chr4B 95.477 199 4 1 4304 4497 449507402 449507600 3.380000e-81 313.0
21 TraesCS6B01G208300 chr2B 80.851 423 41 27 1 385 161210970 161210550 3.400000e-76 296.0
22 TraesCS6B01G208300 chr2B 77.559 254 35 14 1 236 207476750 207476501 2.820000e-27 134.0
23 TraesCS6B01G208300 chr4A 93.103 203 9 1 4300 4497 663370963 663371165 4.400000e-75 292.0
24 TraesCS6B01G208300 chr1B 97.647 170 4 0 4307 4476 580629006 580629175 4.400000e-75 292.0
25 TraesCS6B01G208300 chr1B 97.647 170 4 0 4307 4476 660570372 660570203 4.400000e-75 292.0
26 TraesCS6B01G208300 chr1B 97.059 170 5 0 4307 4476 644021 644190 2.050000e-73 287.0
27 TraesCS6B01G208300 chr1B 85.714 77 10 1 267 342 271712127 271712051 3.730000e-11 80.5
28 TraesCS6B01G208300 chr1B 85.714 77 10 1 267 342 271712406 271712330 3.730000e-11 80.5
29 TraesCS6B01G208300 chr1B 82.278 79 6 4 259 330 168968221 168968144 1.350000e-05 62.1
30 TraesCS6B01G208300 chr1B 82.278 79 6 4 259 330 168986540 168986463 1.350000e-05 62.1
31 TraesCS6B01G208300 chr3B 96.067 178 6 1 4299 4476 717046307 717046131 5.690000e-74 289.0
32 TraesCS6B01G208300 chr3B 80.916 262 29 9 139 379 179382523 179382784 2.140000e-43 187.0
33 TraesCS6B01G208300 chr3B 88.971 136 12 2 1 134 791412510 791412644 1.000000e-36 165.0
34 TraesCS6B01G208300 chr3B 93.269 104 6 1 267 370 791412866 791412968 7.790000e-33 152.0
35 TraesCS6B01G208300 chr6A 80.928 388 29 17 13 356 292624426 292624812 9.590000e-67 265.0
36 TraesCS6B01G208300 chr2A 84.674 261 23 6 1 248 516090607 516090863 1.250000e-60 244.0
37 TraesCS6B01G208300 chr2A 91.489 94 7 1 3930 4023 726434292 726434200 1.310000e-25 128.0
38 TraesCS6B01G208300 chr3D 78.992 238 31 13 16 236 63769644 63769409 1.300000e-30 145.0
39 TraesCS6B01G208300 chr3D 100.000 32 0 0 296 327 545226144 545226113 4.860000e-05 60.2
40 TraesCS6B01G208300 chr6D 95.349 86 4 0 3930 4015 236052610 236052695 2.180000e-28 137.0
41 TraesCS6B01G208300 chr6D 91.935 62 2 1 929 990 358220562 358220504 2.880000e-12 84.2
42 TraesCS6B01G208300 chr1A 92.473 93 6 1 3931 4023 554368288 554368379 1.020000e-26 132.0
43 TraesCS6B01G208300 chr1A 88.235 102 11 1 3924 4024 571275547 571275446 2.200000e-23 121.0
44 TraesCS6B01G208300 chr1A 79.167 192 22 8 20 196 12164140 12163952 2.840000e-22 117.0
45 TraesCS6B01G208300 chr1D 91.489 94 8 0 3927 4020 93124878 93124785 3.650000e-26 130.0
46 TraesCS6B01G208300 chr1D 80.682 88 17 0 299 386 110729694 110729607 8.070000e-08 69.4
47 TraesCS6B01G208300 chr1D 80.723 83 16 0 299 381 365219284 365219202 1.040000e-06 65.8
48 TraesCS6B01G208300 chr5A 91.489 94 7 1 3930 4023 458337343 458337251 1.310000e-25 128.0
49 TraesCS6B01G208300 chr5B 77.043 257 34 17 1 236 58193745 58193997 1.700000e-24 124.0
50 TraesCS6B01G208300 chr5B 77.406 239 33 13 16 235 519616587 519616823 6.110000e-24 122.0
51 TraesCS6B01G208300 chr4D 88.235 102 10 2 3930 4031 489441041 489440942 2.200000e-23 121.0
52 TraesCS6B01G208300 chr4D 82.927 82 14 0 303 384 15532534 15532615 1.730000e-09 75.0
53 TraesCS6B01G208300 chr7B 84.167 120 13 5 26 141 568428352 568428235 1.320000e-20 111.0
54 TraesCS6B01G208300 chr7B 76.190 189 25 12 64 236 644221175 644221359 1.040000e-11 82.4
55 TraesCS6B01G208300 chr7D 73.239 355 55 24 20 342 45064174 45064520 4.790000e-15 93.5
56 TraesCS6B01G208300 chr7A 85.965 57 6 2 4177 4232 19236289 19236234 4.860000e-05 60.2
57 TraesCS6B01G208300 chr7A 97.143 35 0 1 4198 4232 130303633 130303666 1.750000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G208300 chr6B 267503306 267507802 4496 False 4011.5 6652 100.0000 1 4497 2 chr6B.!!$F6 4496
1 TraesCS6B01G208300 chr6B 267324960 267329375 4415 False 3938.5 6517 99.5050 1 4497 2 chr6B.!!$F5 4496
2 TraesCS6B01G208300 chr6B 270468197 270470465 2268 False 463.5 483 80.4765 1001 3205 2 chr6B.!!$F7 2204
3 TraesCS6B01G208300 chr6B 270734186 270736454 2268 False 460.5 483 80.4330 1001 3205 2 chr6B.!!$F9 2204
4 TraesCS6B01G208300 chr6B 270583869 270586130 2261 False 457.5 488 80.4045 1001 3205 2 chr6B.!!$F8 2204
5 TraesCS6B01G208300 chr6B 267018904 267021774 2870 False 350.5 499 86.0075 1001 2851 2 chr6B.!!$F4 1850

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
297 298 1.908066 GCGCTCGTTGGATTTCCGTT 61.908 55.000 0.00 0.0 39.43 4.44 F
396 397 2.658593 GTCTCGTGTGTGTGCGCT 60.659 61.111 9.73 0.0 0.00 5.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2699 3720 8.614346 GCAATAAATGGCAATAAACATGTGAAT 58.386 29.630 0.0 0.0 0.0 2.57 R
3798 4851 8.000780 AGTTCAATATAAGCCTTTCAATCCAC 57.999 34.615 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
297 298 1.908066 GCGCTCGTTGGATTTCCGTT 61.908 55.000 0.00 0.00 39.43 4.44
396 397 2.658593 GTCTCGTGTGTGTGCGCT 60.659 61.111 9.73 0.00 0.00 5.92
1716 1720 7.645942 ACCTATGGCATGGAATAATATCATGT 58.354 34.615 12.93 0.00 40.07 3.21
1788 1792 7.285858 GGTCCTATGGATATAAACTCTCGCTAT 59.714 40.741 0.00 0.00 32.73 2.97
2699 3720 7.542130 CGAATAGCACTATCAGCATTGTACATA 59.458 37.037 0.00 0.00 0.00 2.29
4163 5227 1.445410 TGGCACACGTACGCTGATC 60.445 57.895 16.72 7.60 0.00 2.92
4281 5345 5.910637 TGCAAACATCTTCTGAAATTTGC 57.089 34.783 21.71 21.71 46.26 3.68
4360 5424 2.875080 CGTTTTGTCCGGATTCTGTC 57.125 50.000 7.81 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
297 298 2.046023 CGGCCCATGAAGACAGCA 60.046 61.111 0.0 0.00 0.00 4.41
396 397 4.023365 CCGACCCGTTTTATTTACAAACCA 60.023 41.667 0.0 0.00 31.46 3.67
2699 3720 8.614346 GCAATAAATGGCAATAAACATGTGAAT 58.386 29.630 0.0 0.00 0.00 2.57
3798 4851 8.000780 AGTTCAATATAAGCCTTTCAATCCAC 57.999 34.615 0.0 0.00 0.00 4.02
4146 5210 0.099968 TAGATCAGCGTACGTGTGCC 59.900 55.000 17.9 9.72 0.00 5.01
4360 5424 1.677633 CAAACCCCTACCCAAGCGG 60.678 63.158 0.0 0.00 37.81 5.52
4363 5427 1.386550 CCCCAAACCCCTACCCAAG 59.613 63.158 0.0 0.00 0.00 3.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.