Multiple sequence alignment - TraesCS6B01G208200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G208200 chr6B 100.000 3042 0 0 896 3937 267325763 267328804 0.000000e+00 5618.0
1 TraesCS6B01G208200 chr6B 99.408 3042 7 1 896 3937 267504201 267507231 0.000000e+00 5507.0
2 TraesCS6B01G208200 chr6B 100.000 834 0 0 1 834 267324868 267325701 0.000000e+00 1541.0
3 TraesCS6B01G208200 chr6B 99.640 833 3 0 2 834 267503215 267504047 0.000000e+00 1522.0
4 TraesCS6B01G208200 chr6B 84.722 504 72 5 1001 1500 267018904 267019406 2.110000e-137 499.0
5 TraesCS6B01G208200 chr6B 84.325 504 73 6 1001 1500 270583869 270584370 4.570000e-134 488.0
6 TraesCS6B01G208200 chr6B 84.127 504 75 5 1001 1500 270468197 270468699 2.130000e-132 483.0
7 TraesCS6B01G208200 chr6B 84.127 504 75 5 1001 1500 270734186 270734688 2.130000e-132 483.0
8 TraesCS6B01G208200 chr6B 82.411 506 57 14 1 477 528679559 528680061 2.830000e-111 412.0
9 TraesCS6B01G208200 chr6B 81.299 508 81 8 2700 3205 270469970 270470465 2.200000e-107 399.0
10 TraesCS6B01G208200 chr6B 81.102 508 82 8 2700 3205 270585635 270586130 1.030000e-105 394.0
11 TraesCS6B01G208200 chr6B 81.102 508 82 8 2700 3205 270735959 270736454 1.030000e-105 394.0
12 TraesCS6B01G208200 chr6B 87.079 356 28 13 1 340 89440987 89441340 1.720000e-103 387.0
13 TraesCS6B01G208200 chr6B 86.740 181 19 4 2675 2851 267021595 267021774 3.100000e-46 196.0
14 TraesCS6B01G208200 chr6B 93.750 128 7 1 350 476 89441378 89441505 1.440000e-44 191.0
15 TraesCS6B01G208200 chr6B 90.476 63 3 1 929 991 539620903 539620844 3.260000e-11 80.5
16 TraesCS6B01G208200 chr6A 82.573 482 40 16 9 448 292624333 292624812 6.170000e-103 385.0
17 TraesCS6B01G208200 chr2A 86.686 353 29 7 1 340 516090516 516090863 3.710000e-100 375.0
18 TraesCS6B01G208200 chr3B 89.474 228 21 2 1 226 791412418 791412644 6.440000e-73 285.0
19 TraesCS6B01G208200 chr3B 80.916 262 29 9 231 471 179382523 179382784 1.870000e-43 187.0
20 TraesCS6B01G208200 chr3B 92.308 104 7 1 359 462 791412866 791412968 3.170000e-31 147.0
21 TraesCS6B01G208200 chr3D 81.361 338 44 13 7 328 63769743 63769409 1.400000e-64 257.0
22 TraesCS6B01G208200 chr2B 80.294 340 45 14 7 328 207476836 207476501 1.830000e-58 237.0
23 TraesCS6B01G208200 chr5B 79.943 349 45 17 1 328 58193653 58193997 2.370000e-57 233.0
24 TraesCS6B01G208200 chr7B 83.122 237 32 7 1 233 568428467 568428235 3.990000e-50 209.0
25 TraesCS6B01G208200 chr4D 84.404 218 28 4 1 216 15532116 15532329 3.990000e-50 209.0
26 TraesCS6B01G208200 chr1A 80.135 297 40 9 7 288 12164244 12163952 1.850000e-48 204.0
27 TraesCS6B01G208200 chr6D 91.935 62 2 1 929 990 358220562 358220504 2.520000e-12 84.2
28 TraesCS6B01G208200 chr1D 81.319 91 17 0 388 478 110729697 110729607 1.520000e-09 75.0
29 TraesCS6B01G208200 chr1D 81.395 86 16 0 388 473 365219287 365219202 1.960000e-08 71.3
30 TraesCS6B01G208200 chr1B 83.544 79 5 4 351 422 168968221 168968144 2.540000e-07 67.6
31 TraesCS6B01G208200 chr1B 83.544 79 5 4 351 422 168986540 168986463 2.540000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G208200 chr6B 267324868 267328804 3936 False 3579.5 5618 100.0000 1 3937 2 chr6B.!!$F4 3936
1 TraesCS6B01G208200 chr6B 267503215 267507231 4016 False 3514.5 5507 99.5240 2 3937 2 chr6B.!!$F5 3935
2 TraesCS6B01G208200 chr6B 270468197 270470465 2268 False 441.0 483 82.7130 1001 3205 2 chr6B.!!$F6 2204
3 TraesCS6B01G208200 chr6B 270583869 270586130 2261 False 441.0 488 82.7135 1001 3205 2 chr6B.!!$F7 2204
4 TraesCS6B01G208200 chr6B 270734186 270736454 2268 False 438.5 483 82.6145 1001 3205 2 chr6B.!!$F8 2204
5 TraesCS6B01G208200 chr6B 528679559 528680061 502 False 412.0 412 82.4110 1 477 1 chr6B.!!$F1 476
6 TraesCS6B01G208200 chr6B 267018904 267021774 2870 False 347.5 499 85.7310 1001 2851 2 chr6B.!!$F3 1850
7 TraesCS6B01G208200 chr6B 89440987 89441505 518 False 289.0 387 90.4145 1 476 2 chr6B.!!$F2 475
8 TraesCS6B01G208200 chr3B 791412418 791412968 550 False 216.0 285 90.8910 1 462 2 chr3B.!!$F2 461

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
389 483 1.708027 CGCTCGTTGGATTTCCGTC 59.292 57.895 0.00 0.0 39.43 4.79 F
488 582 3.702555 GTCTCGTGTGTGTGCGCC 61.703 66.667 4.18 0.0 0.00 6.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2818 4055 2.877786 GGAAATTTTGCACAAACCTGGG 59.122 45.455 0.0 0.0 0.0 4.45 R
3798 5036 8.773033 AGTTCAATATAAGCCTTTCAATCCAT 57.227 30.769 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 6.683090 TCGTGTATGCAAATTTTGTTTAGC 57.317 33.333 10.65 0.0 0.00 3.09
389 483 1.708027 CGCTCGTTGGATTTCCGTC 59.292 57.895 0.00 0.0 39.43 4.79
488 582 3.702555 GTCTCGTGTGTGTGCGCC 61.703 66.667 4.18 0.0 0.00 6.53
2818 4055 3.243168 TGTGTCTCTGTTGAAATGCTTGC 60.243 43.478 0.00 0.0 0.00 4.01
3276 4514 9.878599 AGTGACTTGTTATCATTTTTCTTTACG 57.121 29.630 0.00 0.0 0.00 3.18
3863 5101 3.685139 AAGATTTTCTGAGTGCCGAGA 57.315 42.857 0.00 0.0 0.00 4.04
3864 5102 3.244033 AGATTTTCTGAGTGCCGAGAG 57.756 47.619 0.00 0.0 0.00 3.20
3865 5103 2.564947 AGATTTTCTGAGTGCCGAGAGT 59.435 45.455 0.00 0.0 0.00 3.24
3866 5104 2.154854 TTTTCTGAGTGCCGAGAGTG 57.845 50.000 0.00 0.0 0.00 3.51
3867 5105 0.319900 TTTCTGAGTGCCGAGAGTGC 60.320 55.000 0.00 0.0 0.00 4.40
3868 5106 1.181741 TTCTGAGTGCCGAGAGTGCT 61.182 55.000 0.00 0.0 0.00 4.40
3869 5107 1.445754 CTGAGTGCCGAGAGTGCTG 60.446 63.158 0.00 0.0 0.00 4.41
3870 5108 2.152297 CTGAGTGCCGAGAGTGCTGT 62.152 60.000 0.00 0.0 0.00 4.40
3871 5109 1.005630 GAGTGCCGAGAGTGCTGTT 60.006 57.895 0.00 0.0 0.00 3.16
3872 5110 1.005630 AGTGCCGAGAGTGCTGTTC 60.006 57.895 0.00 0.0 0.00 3.18
3873 5111 1.300931 GTGCCGAGAGTGCTGTTCA 60.301 57.895 0.00 0.0 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 8.759641 TGGAAACGTGAACATATTTTGAAATTG 58.240 29.630 0.00 0.00 0.00 2.32
389 483 3.197790 CGGCCCATGAAGACAGCG 61.198 66.667 0.00 0.00 0.00 5.18
488 582 4.150343 CGACCCGTTTTATTTACAAACCG 58.850 43.478 0.00 0.00 31.46 4.44
2818 4055 2.877786 GGAAATTTTGCACAAACCTGGG 59.122 45.455 0.00 0.00 0.00 4.45
3798 5036 8.773033 AGTTCAATATAAGCCTTTCAATCCAT 57.227 30.769 0.00 0.00 0.00 3.41
3863 5101 4.581824 ACATTTCATGACTTGAACAGCACT 59.418 37.500 10.31 0.00 43.99 4.40
3864 5102 4.863491 ACATTTCATGACTTGAACAGCAC 58.137 39.130 10.31 0.00 43.99 4.40
3865 5103 5.300034 AGAACATTTCATGACTTGAACAGCA 59.700 36.000 10.31 0.00 43.99 4.41
3866 5104 5.628193 CAGAACATTTCATGACTTGAACAGC 59.372 40.000 10.31 0.00 43.99 4.40
3867 5105 5.628193 GCAGAACATTTCATGACTTGAACAG 59.372 40.000 10.31 2.74 43.99 3.16
3868 5106 5.300034 AGCAGAACATTTCATGACTTGAACA 59.700 36.000 10.31 0.00 43.99 3.18
3869 5107 5.766222 AGCAGAACATTTCATGACTTGAAC 58.234 37.500 10.31 4.83 43.99 3.18
3870 5108 5.048504 GGAGCAGAACATTTCATGACTTGAA 60.049 40.000 10.31 0.00 42.62 2.69
3871 5109 4.456911 GGAGCAGAACATTTCATGACTTGA 59.543 41.667 10.31 0.00 0.00 3.02
3872 5110 4.380233 GGGAGCAGAACATTTCATGACTTG 60.380 45.833 0.00 0.00 0.00 3.16
3873 5111 3.760684 GGGAGCAGAACATTTCATGACTT 59.239 43.478 0.00 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.