Multiple sequence alignment - TraesCS6B01G203900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G203900 chr6B 100.000 4300 0 0 1 4300 251385444 251381145 0.000000e+00 7941.0
1 TraesCS6B01G203900 chr6B 99.442 4303 19 5 1 4300 251547011 251542711 0.000000e+00 7808.0
2 TraesCS6B01G203900 chr6B 84.848 66 6 1 415 476 337834128 337834193 3.590000e-06 63.9
3 TraesCS6B01G203900 chr6B 92.683 41 3 0 436 476 232327498 232327458 4.640000e-05 60.2
4 TraesCS6B01G203900 chr1D 84.580 441 60 7 3863 4300 467586050 467586485 8.540000e-117 431.0
5 TraesCS6B01G203900 chr1D 87.273 110 9 5 2464 2570 338937372 338937265 2.100000e-23 121.0
6 TraesCS6B01G203900 chr1D 95.238 42 2 0 435 476 203317131 203317172 2.780000e-07 67.6
7 TraesCS6B01G203900 chr7D 83.550 462 72 4 3841 4300 53522954 53523413 3.070000e-116 429.0
8 TraesCS6B01G203900 chr1B 81.913 481 82 5 3821 4300 460576221 460576697 6.700000e-108 401.0
9 TraesCS6B01G203900 chr1B 89.091 110 7 5 2464 2570 24349053 24349160 9.700000e-27 132.0
10 TraesCS6B01G203900 chr1B 84.298 121 13 6 2463 2581 660672130 660672014 3.510000e-21 113.0
11 TraesCS6B01G203900 chr1B 93.478 46 3 0 3724 3769 670093980 670094025 7.720000e-08 69.4
12 TraesCS6B01G203900 chr1B 93.478 46 3 0 3724 3769 670271461 670271416 7.720000e-08 69.4
13 TraesCS6B01G203900 chr5B 81.663 469 73 12 3837 4300 540256791 540256331 1.130000e-100 377.0
14 TraesCS6B01G203900 chr7A 80.512 508 84 15 3793 4296 503451966 503452462 4.060000e-100 375.0
15 TraesCS6B01G203900 chr2D 82.393 443 67 11 3863 4300 54022153 54021717 4.060000e-100 375.0
16 TraesCS6B01G203900 chr6D 81.316 471 77 9 3837 4300 157154177 157154643 5.250000e-99 372.0
17 TraesCS6B01G203900 chr6D 80.000 110 18 2 371 476 249953702 249953811 1.280000e-10 78.7
18 TraesCS6B01G203900 chr2B 79.035 539 94 14 3768 4300 23264472 23264997 6.840000e-93 351.0
19 TraesCS6B01G203900 chr2B 84.375 128 13 7 2458 2581 28337573 28337697 7.550000e-23 119.0
20 TraesCS6B01G203900 chr3A 88.991 109 9 3 2464 2570 49871208 49871101 9.700000e-27 132.0
21 TraesCS6B01G203900 chr7B 88.182 110 8 5 2464 2570 459908919 459908812 4.510000e-25 126.0
22 TraesCS6B01G203900 chr7B 88.182 110 8 5 2464 2570 615290497 615290604 4.510000e-25 126.0
23 TraesCS6B01G203900 chr7B 93.478 46 3 0 3724 3769 122780554 122780599 7.720000e-08 69.4
24 TraesCS6B01G203900 chr4D 88.182 110 8 5 2464 2570 386984669 386984776 4.510000e-25 126.0
25 TraesCS6B01G203900 chr6A 79.817 109 15 4 374 476 346600341 346600234 5.960000e-09 73.1
26 TraesCS6B01G203900 chrUn 93.478 46 3 0 3724 3769 155121780 155121735 7.720000e-08 69.4
27 TraesCS6B01G203900 chrUn 93.478 46 3 0 3724 3769 391473853 391473808 7.720000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G203900 chr6B 251381145 251385444 4299 True 7941 7941 100.000 1 4300 1 chr6B.!!$R2 4299
1 TraesCS6B01G203900 chr6B 251542711 251547011 4300 True 7808 7808 99.442 1 4300 1 chr6B.!!$R3 4299
2 TraesCS6B01G203900 chr2B 23264472 23264997 525 False 351 351 79.035 3768 4300 1 chr2B.!!$F1 532

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
25 26 2.360350 ACTCATGTTGGCCAGGCG 60.360 61.111 5.11 0.00 0.00 5.52 F
357 358 2.584064 CGTGCAGGTAGGATGGCA 59.416 61.111 0.00 0.00 0.00 4.92 F
1723 1726 3.550233 CGTAGTGTGGTGAGGATTATCCG 60.550 52.174 5.50 0.00 42.75 4.18 F
2587 2590 6.001460 TCCGTATTGCAATCTATAAAAGGGG 58.999 40.000 16.86 1.39 0.00 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1380 1382 2.099427 CCCGTTTCTGCTAGACCTAGTC 59.901 54.545 0.0 0.0 35.65 2.59 R
1723 1726 3.801307 TTTTCTTAGTCCCCCTTGTCC 57.199 47.619 0.0 0.0 0.00 4.02 R
2742 2745 2.031069 ACATAGCTACGCCATAGTGTCG 60.031 50.000 0.0 0.0 37.94 4.35 R
3774 3778 4.992511 TTGGTGTGCCCGCCGTAC 62.993 66.667 0.0 0.0 44.67 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 2.360350 ACTCATGTTGGCCAGGCG 60.360 61.111 5.11 0.00 0.00 5.52
357 358 2.584064 CGTGCAGGTAGGATGGCA 59.416 61.111 0.00 0.00 0.00 4.92
1723 1726 3.550233 CGTAGTGTGGTGAGGATTATCCG 60.550 52.174 5.50 0.00 42.75 4.18
2587 2590 6.001460 TCCGTATTGCAATCTATAAAAGGGG 58.999 40.000 16.86 1.39 0.00 4.79
3774 3778 0.737219 GTTGCCCAGCTAAGAGCATG 59.263 55.000 0.64 0.00 45.56 4.06
4028 4034 1.200483 CTTCGTCGGAATGATGTCGG 58.800 55.000 0.00 0.00 35.01 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 3.286694 ATGGACGCCTGGCCAACAT 62.287 57.895 14.12 11.59 37.78 2.71
161 162 0.747283 GGATTGCTCCCTGTGCTCTG 60.747 60.000 0.00 0.00 35.28 3.35
192 193 2.066262 CGTGTCGGCTAGTTTGTTCAT 58.934 47.619 0.00 0.00 0.00 2.57
357 358 1.074623 CCTCTCAGGGGCTCTCCAT 60.075 63.158 0.00 0.00 37.22 3.41
1319 1321 6.952773 TTGCGGGCTAATATTGTAAAATCT 57.047 33.333 0.00 0.00 0.00 2.40
1380 1382 2.099427 CCCGTTTCTGCTAGACCTAGTC 59.901 54.545 0.00 0.00 35.65 2.59
1723 1726 3.801307 TTTTCTTAGTCCCCCTTGTCC 57.199 47.619 0.00 0.00 0.00 4.02
2601 2604 4.462483 GCTTTTGTCCAATGTATTCCCTCA 59.538 41.667 0.00 0.00 0.00 3.86
2742 2745 2.031069 ACATAGCTACGCCATAGTGTCG 60.031 50.000 0.00 0.00 37.94 4.35
3774 3778 4.992511 TTGGTGTGCCCGCCGTAC 62.993 66.667 0.00 0.00 44.67 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.