Multiple sequence alignment - TraesCS6B01G202100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G202100 chr6B 100.000 2928 0 0 1 2928 246774676 246771749 0.000000e+00 5408
1 TraesCS6B01G202100 chr6B 99.542 2404 11 0 525 2928 246678047 246675644 0.000000e+00 4379
2 TraesCS6B01G202100 chr6B 99.550 1556 7 0 1373 2928 246362070 246360515 0.000000e+00 2835
3 TraesCS6B01G202100 chr6B 99.434 1237 6 1 1693 2928 246510327 246509091 0.000000e+00 2244
4 TraesCS6B01G202100 chr6B 99.292 847 6 0 525 1371 246514329 246513483 0.000000e+00 1531
5 TraesCS6B01G202100 chr6B 94.677 526 26 2 2 525 137387685 137387160 0.000000e+00 815
6 TraesCS6B01G202100 chr6B 97.297 222 6 0 2556 2777 703264218 703263997 7.660000e-101 377
7 TraesCS6B01G202100 chr6B 96.203 158 6 0 2771 2928 703263479 703263322 2.890000e-65 259
8 TraesCS6B01G202100 chrUn 99.459 2405 12 1 525 2928 190887851 190885447 0.000000e+00 4368
9 TraesCS6B01G202100 chrUn 99.292 847 6 0 525 1371 355878988 355879834 0.000000e+00 1531
10 TraesCS6B01G202100 chrUn 88.762 525 56 3 3 525 143851234 143850711 8.850000e-180 640
11 TraesCS6B01G202100 chr7D 82.172 1694 194 56 830 2450 631925010 631923352 0.000000e+00 1356
12 TraesCS6B01G202100 chr7B 82.341 1529 184 40 977 2450 743451362 743449865 0.000000e+00 1249
13 TraesCS6B01G202100 chr7B 98.099 526 9 1 1 525 458809828 458810353 0.000000e+00 915
14 TraesCS6B01G202100 chr7B 85.605 521 71 4 6 524 619618690 619618172 7.140000e-151 544
15 TraesCS6B01G202100 chr7A 83.502 1382 174 27 1092 2451 736493168 736494517 0.000000e+00 1240
16 TraesCS6B01G202100 chr1B 95.817 526 21 1 1 525 48855578 48856103 0.000000e+00 848
17 TraesCS6B01G202100 chr1B 89.184 527 51 5 3 526 583848911 583849434 0.000000e+00 652
18 TraesCS6B01G202100 chr4B 91.082 527 46 1 1 526 584546025 584546551 0.000000e+00 712
19 TraesCS6B01G202100 chr4B 90.043 231 15 5 2554 2777 592553467 592553238 2.850000e-75 292
20 TraesCS6B01G202100 chr3B 87.313 536 65 1 1619 2154 789453696 789454228 6.940000e-171 610
21 TraesCS6B01G202100 chr3B 92.732 399 27 2 129 525 779035664 779035266 2.530000e-160 575
22 TraesCS6B01G202100 chr3B 78.338 397 63 10 1084 1479 789453315 789453689 4.880000e-58 235
23 TraesCS6B01G202100 chr3B 73.415 410 81 19 2170 2554 789454703 789455109 8.520000e-26 128
24 TraesCS6B01G202100 chr2D 83.497 509 83 1 16 523 531196853 531197361 9.500000e-130 473
25 TraesCS6B01G202100 chr3A 97.748 222 5 0 2556 2777 454039163 454039384 1.650000e-102 383
26 TraesCS6B01G202100 chr3A 95.570 158 7 0 2771 2928 454039901 454040058 1.350000e-63 254
27 TraesCS6B01G202100 chr6D 90.393 229 15 4 2556 2777 82683297 82683069 7.940000e-76 294
28 TraesCS6B01G202100 chr4A 89.520 229 16 5 2556 2777 600742040 600741813 1.720000e-72 283


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G202100 chr6B 246771749 246774676 2927 True 5408.000000 5408 100.000000 1 2928 1 chr6B.!!$R4 2927
1 TraesCS6B01G202100 chr6B 246675644 246678047 2403 True 4379.000000 4379 99.542000 525 2928 1 chr6B.!!$R3 2403
2 TraesCS6B01G202100 chr6B 246360515 246362070 1555 True 2835.000000 2835 99.550000 1373 2928 1 chr6B.!!$R2 1555
3 TraesCS6B01G202100 chr6B 246509091 246514329 5238 True 1887.500000 2244 99.363000 525 2928 2 chr6B.!!$R5 2403
4 TraesCS6B01G202100 chr6B 137387160 137387685 525 True 815.000000 815 94.677000 2 525 1 chr6B.!!$R1 523
5 TraesCS6B01G202100 chr6B 703263322 703264218 896 True 318.000000 377 96.750000 2556 2928 2 chr6B.!!$R6 372
6 TraesCS6B01G202100 chrUn 190885447 190887851 2404 True 4368.000000 4368 99.459000 525 2928 1 chrUn.!!$R2 2403
7 TraesCS6B01G202100 chrUn 355878988 355879834 846 False 1531.000000 1531 99.292000 525 1371 1 chrUn.!!$F1 846
8 TraesCS6B01G202100 chrUn 143850711 143851234 523 True 640.000000 640 88.762000 3 525 1 chrUn.!!$R1 522
9 TraesCS6B01G202100 chr7D 631923352 631925010 1658 True 1356.000000 1356 82.172000 830 2450 1 chr7D.!!$R1 1620
10 TraesCS6B01G202100 chr7B 743449865 743451362 1497 True 1249.000000 1249 82.341000 977 2450 1 chr7B.!!$R2 1473
11 TraesCS6B01G202100 chr7B 458809828 458810353 525 False 915.000000 915 98.099000 1 525 1 chr7B.!!$F1 524
12 TraesCS6B01G202100 chr7B 619618172 619618690 518 True 544.000000 544 85.605000 6 524 1 chr7B.!!$R1 518
13 TraesCS6B01G202100 chr7A 736493168 736494517 1349 False 1240.000000 1240 83.502000 1092 2451 1 chr7A.!!$F1 1359
14 TraesCS6B01G202100 chr1B 48855578 48856103 525 False 848.000000 848 95.817000 1 525 1 chr1B.!!$F1 524
15 TraesCS6B01G202100 chr1B 583848911 583849434 523 False 652.000000 652 89.184000 3 526 1 chr1B.!!$F2 523
16 TraesCS6B01G202100 chr4B 584546025 584546551 526 False 712.000000 712 91.082000 1 526 1 chr4B.!!$F1 525
17 TraesCS6B01G202100 chr3B 789453315 789455109 1794 False 324.333333 610 79.688667 1084 2554 3 chr3B.!!$F1 1470
18 TraesCS6B01G202100 chr2D 531196853 531197361 508 False 473.000000 473 83.497000 16 523 1 chr2D.!!$F1 507
19 TraesCS6B01G202100 chr3A 454039163 454040058 895 False 318.500000 383 96.659000 2556 2928 2 chr3A.!!$F1 372

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
150 151 0.39086 CTGGGAGCCTCGGTTATGAG 59.609 60.0 0.0 0.0 35.7 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2004 4980 0.676782 GGCGGCATAGTGACCAAGTT 60.677 55.0 3.07 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 151 0.390860 CTGGGAGCCTCGGTTATGAG 59.609 60.000 0.00 0.0 35.70 2.90
166 167 5.180680 GGTTATGAGGATAAATGGCGTAACC 59.819 44.000 0.00 0.0 39.84 2.85
287 288 6.206243 AGAGGTTGTGAAAGACATCAAGAATG 59.794 38.462 0.00 0.0 41.48 2.67
900 913 8.356657 TGGTTTGTTTTGTCATTATTAGGAGTG 58.643 33.333 0.00 0.0 0.00 3.51
956 971 4.454847 TCGGATTAGTAGGCACTCTTATCG 59.545 45.833 0.00 0.0 41.75 2.92
957 972 4.454847 CGGATTAGTAGGCACTCTTATCGA 59.545 45.833 0.00 0.0 41.75 3.59
1358 1411 0.468029 CCAGGGGAAAGCAAGTGTGT 60.468 55.000 0.00 0.0 0.00 3.72
2004 4980 1.476833 GCGGAAGATGGGCCAAATCTA 60.477 52.381 11.89 0.0 33.17 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 151 1.869132 GGTCGGTTACGCCATTTATCC 59.131 52.381 0.00 0.0 40.69 2.59
155 156 2.125431 CGGGTCGGTTACGCCATT 60.125 61.111 0.00 0.0 40.69 3.16
166 167 2.594119 CTTCTAGTGTCGCCGGGTCG 62.594 65.000 2.18 0.0 0.00 4.79
900 913 5.127194 GGAATTTGTATCCAAAGGAACCTCC 59.873 44.000 0.00 0.0 43.45 4.30
956 971 9.464714 CGTATTCATAGGCATATATAGTGGTTC 57.535 37.037 0.00 0.0 0.00 3.62
957 972 7.926555 GCGTATTCATAGGCATATATAGTGGTT 59.073 37.037 6.62 0.0 42.10 3.67
1358 1411 3.104512 TCCTTTCGGAAGATAAGCTCCA 58.895 45.455 4.56 0.0 41.60 3.86
2004 4980 0.676782 GGCGGCATAGTGACCAAGTT 60.677 55.000 3.07 0.0 0.00 2.66
2502 5961 5.353400 ACATCAACACATACTTGATCAGCAG 59.647 40.000 0.00 0.0 36.42 4.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.