Multiple sequence alignment - TraesCS6B01G201900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G201900 chr6B 100.000 2928 0 0 1 2928 246678571 246675644 0.000000e+00 5408.0
1 TraesCS6B01G201900 chr6B 99.542 2404 11 0 525 2928 246774152 246771749 0.000000e+00 4379.0
2 TraesCS6B01G201900 chr6B 99.614 1556 6 0 1373 2928 246362070 246360515 0.000000e+00 2841.0
3 TraesCS6B01G201900 chr6B 99.416 1371 8 0 1 1371 246514853 246513483 0.000000e+00 2488.0
4 TraesCS6B01G201900 chr6B 99.677 1237 3 1 1693 2928 246510327 246509091 0.000000e+00 2261.0
5 TraesCS6B01G201900 chr6B 98.658 298 2 1 176 473 246796769 246796474 7.190000e-146 527.0
6 TraesCS6B01G201900 chr6B 97.297 222 6 0 2556 2777 703264218 703263997 7.660000e-101 377.0
7 TraesCS6B01G201900 chr6B 96.203 158 6 0 2771 2928 703263479 703263322 2.890000e-65 259.0
8 TraesCS6B01G201900 chr6B 98.182 55 1 0 474 528 246774936 246774882 2.400000e-16 97.1
9 TraesCS6B01G201900 chrUn 99.556 2929 12 1 1 2928 190888375 190885447 0.000000e+00 5336.0
10 TraesCS6B01G201900 chrUn 99.416 1371 8 0 1 1371 355878464 355879834 0.000000e+00 2488.0
11 TraesCS6B01G201900 chr7D 82.586 1694 187 57 830 2450 631925010 631923352 0.000000e+00 1395.0
12 TraesCS6B01G201900 chr7B 82.603 1529 180 41 977 2450 743451362 743449865 0.000000e+00 1271.0
13 TraesCS6B01G201900 chr7A 80.991 1736 212 58 799 2451 736492817 736494517 0.000000e+00 1269.0
14 TraesCS6B01G201900 chr3B 87.500 536 64 1 1619 2154 789453696 789454228 1.490000e-172 616.0
15 TraesCS6B01G201900 chr3B 78.338 397 63 10 1084 1479 789453315 789453689 4.880000e-58 235.0
16 TraesCS6B01G201900 chr3B 73.594 409 80 20 2171 2554 789454704 789455109 6.580000e-27 132.0
17 TraesCS6B01G201900 chr3A 97.748 222 5 0 2556 2777 454039163 454039384 1.650000e-102 383.0
18 TraesCS6B01G201900 chr3A 95.570 158 7 0 2771 2928 454039901 454040058 1.350000e-63 254.0
19 TraesCS6B01G201900 chr3A 84.348 115 12 4 249 363 716071897 716071789 1.110000e-19 108.0
20 TraesCS6B01G201900 chr6D 90.393 229 15 4 2556 2777 82683297 82683069 7.940000e-76 294.0
21 TraesCS6B01G201900 chr4B 90.043 231 15 5 2554 2777 592553467 592553238 2.850000e-75 292.0
22 TraesCS6B01G201900 chr4A 89.520 229 16 5 2556 2777 600742040 600741813 1.720000e-72 283.0
23 TraesCS6B01G201900 chr2D 86.082 194 22 2 173 366 43098665 43098853 1.380000e-48 204.0
24 TraesCS6B01G201900 chr2D 94.958 119 6 0 65 183 154110787 154110669 1.390000e-43 187.0
25 TraesCS6B01G201900 chr2D 91.667 72 6 0 1 72 18309902 18309973 1.860000e-17 100.0
26 TraesCS6B01G201900 chr5B 94.737 114 6 0 68 181 558558699 558558586 8.340000e-41 178.0
27 TraesCS6B01G201900 chr5B 87.805 123 6 8 245 365 124251697 124251812 5.090000e-28 135.0
28 TraesCS6B01G201900 chr5D 92.683 123 7 2 63 183 391376996 391376874 3.000000e-40 176.0
29 TraesCS6B01G201900 chr2B 93.966 116 7 0 67 182 25366095 25365980 3.000000e-40 176.0
30 TraesCS6B01G201900 chr1B 93.966 116 6 1 63 177 15616820 15616935 1.080000e-39 174.0
31 TraesCS6B01G201900 chr1A 93.162 117 8 0 62 178 119717288 119717404 3.880000e-39 172.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G201900 chr6B 246675644 246678571 2927 True 5408.000000 5408 100.000000 1 2928 1 chr6B.!!$R2 2927
1 TraesCS6B01G201900 chr6B 246360515 246362070 1555 True 2841.000000 2841 99.614000 1373 2928 1 chr6B.!!$R1 1555
2 TraesCS6B01G201900 chr6B 246509091 246514853 5762 True 2374.500000 2488 99.546500 1 2928 2 chr6B.!!$R4 2927
3 TraesCS6B01G201900 chr6B 246771749 246774936 3187 True 2238.050000 4379 98.862000 474 2928 2 chr6B.!!$R5 2454
4 TraesCS6B01G201900 chr6B 703263322 703264218 896 True 318.000000 377 96.750000 2556 2928 2 chr6B.!!$R6 372
5 TraesCS6B01G201900 chrUn 190885447 190888375 2928 True 5336.000000 5336 99.556000 1 2928 1 chrUn.!!$R1 2927
6 TraesCS6B01G201900 chrUn 355878464 355879834 1370 False 2488.000000 2488 99.416000 1 1371 1 chrUn.!!$F1 1370
7 TraesCS6B01G201900 chr7D 631923352 631925010 1658 True 1395.000000 1395 82.586000 830 2450 1 chr7D.!!$R1 1620
8 TraesCS6B01G201900 chr7B 743449865 743451362 1497 True 1271.000000 1271 82.603000 977 2450 1 chr7B.!!$R1 1473
9 TraesCS6B01G201900 chr7A 736492817 736494517 1700 False 1269.000000 1269 80.991000 799 2451 1 chr7A.!!$F1 1652
10 TraesCS6B01G201900 chr3B 789453315 789455109 1794 False 327.666667 616 79.810667 1084 2554 3 chr3B.!!$F1 1470
11 TraesCS6B01G201900 chr3A 454039163 454040058 895 False 318.500000 383 96.659000 2556 2928 2 chr3A.!!$F1 372

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
91 92 1.75538 ACTCCCTCCGTTCGGAATTAG 59.245 52.381 14.79 13.09 33.41 1.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2280 6469 5.466393 CACATACGATATGATGGCTTGTTGA 59.534 40.0 10.64 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 2.339418 TGTGCAACGGGTTATAGTTCG 58.661 47.619 0.00 0.00 42.39 3.95
83 84 6.922407 GTCACTAAATATTACTCCCTCCGTTC 59.078 42.308 0.00 0.00 0.00 3.95
91 92 1.755380 ACTCCCTCCGTTCGGAATTAG 59.245 52.381 14.79 13.09 33.41 1.73
150 151 7.936496 TGTTCTAGATACATCCATTTTTGCA 57.064 32.000 0.00 0.00 0.00 4.08
161 162 8.086851 ACATCCATTTTTGCAACAAGTAATTC 57.913 30.769 0.00 0.00 0.00 2.17
172 173 2.301009 ACAAGTAATTCCGAACGGAGGT 59.699 45.455 15.34 10.24 46.06 3.85
2280 6469 4.383173 TGTTGCGCATCAGATCTTCATAT 58.617 39.130 16.92 0.00 0.00 1.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 2.158755 ACAATGGCAGCCTGGAGTATAC 60.159 50.000 14.15 0.00 0.00 1.47
83 84 4.334443 CATTTCTGCGACAACTAATTCCG 58.666 43.478 0.00 0.00 0.00 4.30
91 92 4.572389 AGATACATCCATTTCTGCGACAAC 59.428 41.667 0.00 0.00 0.00 3.32
147 148 2.224549 CCGTTCGGAATTACTTGTTGCA 59.775 45.455 5.19 0.00 0.00 4.08
150 151 3.244318 ACCTCCGTTCGGAATTACTTGTT 60.244 43.478 14.79 0.00 33.41 2.83
161 162 3.737850 ACTATCTACTACCTCCGTTCGG 58.262 50.000 4.74 4.74 0.00 4.30
172 173 6.264744 GTCAATGGCCACTGTACTATCTACTA 59.735 42.308 14.91 0.00 0.00 1.82
2280 6469 5.466393 CACATACGATATGATGGCTTGTTGA 59.534 40.000 10.64 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.