Multiple sequence alignment - TraesCS6B01G201200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G201200 chr6B 100.000 2322 0 0 1 2322 243242388 243244709 0.000000e+00 4289
1 TraesCS6B01G201200 chr6B 98.509 1476 19 3 1 1474 22813120 22811646 0.000000e+00 2601
2 TraesCS6B01G201200 chr7B 98.712 1475 17 2 1 1474 664294594 664296067 0.000000e+00 2617
3 TraesCS6B01G201200 chr7B 97.897 1474 31 0 1 1474 15309593 15311066 0.000000e+00 2551
4 TraesCS6B01G201200 chr7B 97.831 1475 31 1 1 1474 415417069 415418543 0.000000e+00 2545
5 TraesCS6B01G201200 chr7B 94.316 862 34 7 1471 2317 680724512 680725373 0.000000e+00 1306
6 TraesCS6B01G201200 chr5B 98.100 1474 28 0 1 1474 109899185 109897712 0.000000e+00 2567
7 TraesCS6B01G201200 chr5B 94.694 867 31 2 1471 2322 614627086 614627952 0.000000e+00 1332
8 TraesCS6B01G201200 chr5B 97.201 786 21 1 1471 2255 415772345 415771560 0.000000e+00 1328
9 TraesCS6B01G201200 chr3B 97.829 1474 32 0 1 1474 14264716 14266189 0.000000e+00 2545
10 TraesCS6B01G201200 chr3B 97.626 1474 34 1 1 1474 28344929 28346401 0.000000e+00 2527
11 TraesCS6B01G201200 chr3B 95.156 867 27 2 1471 2322 737834121 737833255 0.000000e+00 1354
12 TraesCS6B01G201200 chr3B 95.400 826 21 4 1512 2322 9254646 9253823 0.000000e+00 1299
13 TraesCS6B01G201200 chr1B 97.761 1474 26 2 1 1474 615476943 615478409 0.000000e+00 2532
14 TraesCS6B01G201200 chr1B 97.558 1474 29 2 1 1474 618191020 618189554 0.000000e+00 2516
15 TraesCS6B01G201200 chr2B 95.040 867 27 5 1471 2322 631380611 631379746 0.000000e+00 1349
16 TraesCS6B01G201200 chr2D 93.556 869 36 10 1471 2322 640875067 640874202 0.000000e+00 1277
17 TraesCS6B01G201200 chr3D 94.716 776 36 5 1471 2243 448308937 448308164 0.000000e+00 1201
18 TraesCS6B01G201200 chr3D 89.474 893 53 20 1471 2322 615068140 615069032 0.000000e+00 1090
19 TraesCS6B01G201200 chr3D 91.667 72 5 1 2252 2322 448308119 448308048 5.280000e-17 99
20 TraesCS6B01G201200 chr5D 93.814 776 42 5 1471 2243 60519677 60518905 0.000000e+00 1162
21 TraesCS6B01G201200 chr5D 93.056 72 4 1 2252 2322 60518858 60518787 1.130000e-18 104
22 TraesCS6B01G201200 chr4A 93.151 73 2 3 2252 2322 534188095 534188024 1.130000e-18 104
23 TraesCS6B01G201200 chr3A 93.151 73 2 3 2252 2322 366877296 366877225 1.130000e-18 104


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G201200 chr6B 243242388 243244709 2321 False 4289 4289 100.0000 1 2322 1 chr6B.!!$F1 2321
1 TraesCS6B01G201200 chr6B 22811646 22813120 1474 True 2601 2601 98.5090 1 1474 1 chr6B.!!$R1 1473
2 TraesCS6B01G201200 chr7B 664294594 664296067 1473 False 2617 2617 98.7120 1 1474 1 chr7B.!!$F3 1473
3 TraesCS6B01G201200 chr7B 15309593 15311066 1473 False 2551 2551 97.8970 1 1474 1 chr7B.!!$F1 1473
4 TraesCS6B01G201200 chr7B 415417069 415418543 1474 False 2545 2545 97.8310 1 1474 1 chr7B.!!$F2 1473
5 TraesCS6B01G201200 chr7B 680724512 680725373 861 False 1306 1306 94.3160 1471 2317 1 chr7B.!!$F4 846
6 TraesCS6B01G201200 chr5B 109897712 109899185 1473 True 2567 2567 98.1000 1 1474 1 chr5B.!!$R1 1473
7 TraesCS6B01G201200 chr5B 614627086 614627952 866 False 1332 1332 94.6940 1471 2322 1 chr5B.!!$F1 851
8 TraesCS6B01G201200 chr5B 415771560 415772345 785 True 1328 1328 97.2010 1471 2255 1 chr5B.!!$R2 784
9 TraesCS6B01G201200 chr3B 14264716 14266189 1473 False 2545 2545 97.8290 1 1474 1 chr3B.!!$F1 1473
10 TraesCS6B01G201200 chr3B 28344929 28346401 1472 False 2527 2527 97.6260 1 1474 1 chr3B.!!$F2 1473
11 TraesCS6B01G201200 chr3B 737833255 737834121 866 True 1354 1354 95.1560 1471 2322 1 chr3B.!!$R2 851
12 TraesCS6B01G201200 chr3B 9253823 9254646 823 True 1299 1299 95.4000 1512 2322 1 chr3B.!!$R1 810
13 TraesCS6B01G201200 chr1B 615476943 615478409 1466 False 2532 2532 97.7610 1 1474 1 chr1B.!!$F1 1473
14 TraesCS6B01G201200 chr1B 618189554 618191020 1466 True 2516 2516 97.5580 1 1474 1 chr1B.!!$R1 1473
15 TraesCS6B01G201200 chr2B 631379746 631380611 865 True 1349 1349 95.0400 1471 2322 1 chr2B.!!$R1 851
16 TraesCS6B01G201200 chr2D 640874202 640875067 865 True 1277 1277 93.5560 1471 2322 1 chr2D.!!$R1 851
17 TraesCS6B01G201200 chr3D 615068140 615069032 892 False 1090 1090 89.4740 1471 2322 1 chr3D.!!$F1 851
18 TraesCS6B01G201200 chr3D 448308048 448308937 889 True 650 1201 93.1915 1471 2322 2 chr3D.!!$R1 851
19 TraesCS6B01G201200 chr5D 60518787 60519677 890 True 633 1162 93.4350 1471 2322 2 chr5D.!!$R1 851

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
749 750 1.227823 CAGTCCGGCTGTTGTGGAA 60.228 57.895 15.27 0.0 40.27 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1978 1983 1.528129 CTGAGAAGGTTGAGTTGGCC 58.472 55.0 0.0 0.0 0.0 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
749 750 1.227823 CAGTCCGGCTGTTGTGGAA 60.228 57.895 15.27 0.0 40.27 3.53
804 805 1.318576 CCAAGTGGTGTTTCCTGACC 58.681 55.000 0.00 0.0 37.07 4.02
1089 1090 0.544833 TCCCTGTGGGCCGTAACTTA 60.545 55.000 0.00 0.0 43.94 2.24
1101 1102 2.681344 CCGTAACTTAACCATTGCTCCC 59.319 50.000 0.00 0.0 0.00 4.30
1581 1584 2.547218 GCACCTTGTAGAGAAACGGACA 60.547 50.000 0.00 0.0 0.00 4.02
1849 1854 0.966920 TCTTCCGCTCGTCCTTCTTT 59.033 50.000 0.00 0.0 0.00 2.52
2133 2138 2.232208 TGAAGTGATGACTGATGCGAGT 59.768 45.455 0.00 0.0 30.61 4.18
2140 2145 4.388773 TGATGACTGATGCGAGTTTGTTAC 59.611 41.667 0.00 0.0 0.00 2.50
2212 2243 7.559590 AACTTGTTAGTTCCATATCTGATGC 57.440 36.000 0.00 0.0 40.60 3.91
2232 2263 8.054152 TGATGCACTTGTTATTTGTATGTCAT 57.946 30.769 0.00 0.0 0.00 3.06
2306 2352 3.703001 ATACTGTTGCTGTACTTGGCT 57.297 42.857 0.00 0.0 0.00 4.75
2309 2355 3.815809 ACTGTTGCTGTACTTGGCTTTA 58.184 40.909 0.00 0.0 0.00 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
749 750 1.600638 GTAAGCCCTGGCGTACCTT 59.399 57.895 19.56 4.26 45.58 3.50
1089 1090 1.534729 GTTCTTCGGGAGCAATGGTT 58.465 50.000 0.00 0.00 0.00 3.67
1101 1102 0.955919 GCCACTCCCAAGGTTCTTCG 60.956 60.000 0.00 0.00 0.00 3.79
1566 1569 2.483106 CGAGACTGTCCGTTTCTCTACA 59.517 50.000 3.76 0.00 34.72 2.74
1581 1584 5.395546 CCTGTAGAGTACTCCTAACGAGACT 60.396 48.000 19.38 0.00 41.63 3.24
1761 1766 1.816224 TCTATACTGAGCACGTGCACA 59.184 47.619 39.21 36.00 45.16 4.57
1849 1854 2.604686 AAGCACCTCCTCGGCTGA 60.605 61.111 0.00 0.00 38.04 4.26
1978 1983 1.528129 CTGAGAAGGTTGAGTTGGCC 58.472 55.000 0.00 0.00 0.00 5.36
2133 2138 9.706691 CTAGTTCACCAGAATAGAAGTAACAAA 57.293 33.333 0.00 0.00 35.92 2.83
2212 2243 9.546909 GTCTTGATGACATACAAATAACAAGTG 57.453 33.333 0.00 0.00 44.73 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.