Multiple sequence alignment - TraesCS6B01G199100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G199100 chr6B 100.000 2549 0 0 1 2549 238247653 238250201 0 4708
1 TraesCS6B01G199100 chr6B 97.028 572 17 0 1 572 712769564 712770135 0 963
2 TraesCS6B01G199100 chr3B 99.092 1983 17 1 568 2549 702857659 702855677 0 3561
3 TraesCS6B01G199100 chr6A 99.141 1980 14 3 573 2549 507719445 507721424 0 3559
4 TraesCS6B01G199100 chr2B 98.994 1989 17 3 564 2549 776222952 776224940 0 3559
5 TraesCS6B01G199100 chr2B 97.203 572 16 0 1 572 211443732 211444303 0 968
6 TraesCS6B01G199100 chr7A 99.040 1980 17 2 572 2549 39015367 39017346 0 3550
7 TraesCS6B01G199100 chr5B 98.846 1993 18 5 562 2549 641128792 641126800 0 3548
8 TraesCS6B01G199100 chr5B 97.203 572 14 2 1 572 316071078 316071647 0 966
9 TraesCS6B01G199100 chr3A 98.842 1987 19 4 565 2549 54951911 54953895 0 3539
10 TraesCS6B01G199100 chr1B 98.891 1983 21 1 568 2549 302243304 302241322 0 3539
11 TraesCS6B01G199100 chr7B 98.793 1988 19 4 563 2549 202776908 202778891 0 3533
12 TraesCS6B01G199100 chr7B 98.793 1989 16 8 564 2549 743805898 743807881 0 3533
13 TraesCS6B01G199100 chr4B 97.203 572 16 0 1 572 242471778 242472349 0 968
14 TraesCS6B01G199100 chr4B 97.028 572 17 0 1 572 256393808 256394379 0 963
15 TraesCS6B01G199100 chr4B 97.023 571 17 0 2 572 262849577 262850147 0 961
16 TraesCS6B01G199100 chr4B 96.853 572 18 0 1 572 156552720 156553291 0 957
17 TraesCS6B01G199100 chr4B 96.853 572 18 0 1 572 304886725 304887296 0 957
18 TraesCS6B01G199100 chr4B 96.853 572 18 0 1 572 351487004 351486433 0 957


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G199100 chr6B 238247653 238250201 2548 False 4708 4708 100.000 1 2549 1 chr6B.!!$F1 2548
1 TraesCS6B01G199100 chr6B 712769564 712770135 571 False 963 963 97.028 1 572 1 chr6B.!!$F2 571
2 TraesCS6B01G199100 chr3B 702855677 702857659 1982 True 3561 3561 99.092 568 2549 1 chr3B.!!$R1 1981
3 TraesCS6B01G199100 chr6A 507719445 507721424 1979 False 3559 3559 99.141 573 2549 1 chr6A.!!$F1 1976
4 TraesCS6B01G199100 chr2B 776222952 776224940 1988 False 3559 3559 98.994 564 2549 1 chr2B.!!$F2 1985
5 TraesCS6B01G199100 chr2B 211443732 211444303 571 False 968 968 97.203 1 572 1 chr2B.!!$F1 571
6 TraesCS6B01G199100 chr7A 39015367 39017346 1979 False 3550 3550 99.040 572 2549 1 chr7A.!!$F1 1977
7 TraesCS6B01G199100 chr5B 641126800 641128792 1992 True 3548 3548 98.846 562 2549 1 chr5B.!!$R1 1987
8 TraesCS6B01G199100 chr5B 316071078 316071647 569 False 966 966 97.203 1 572 1 chr5B.!!$F1 571
9 TraesCS6B01G199100 chr3A 54951911 54953895 1984 False 3539 3539 98.842 565 2549 1 chr3A.!!$F1 1984
10 TraesCS6B01G199100 chr1B 302241322 302243304 1982 True 3539 3539 98.891 568 2549 1 chr1B.!!$R1 1981
11 TraesCS6B01G199100 chr7B 202776908 202778891 1983 False 3533 3533 98.793 563 2549 1 chr7B.!!$F1 1986
12 TraesCS6B01G199100 chr7B 743805898 743807881 1983 False 3533 3533 98.793 564 2549 1 chr7B.!!$F2 1985
13 TraesCS6B01G199100 chr4B 242471778 242472349 571 False 968 968 97.203 1 572 1 chr4B.!!$F2 571
14 TraesCS6B01G199100 chr4B 256393808 256394379 571 False 963 963 97.028 1 572 1 chr4B.!!$F3 571
15 TraesCS6B01G199100 chr4B 262849577 262850147 570 False 961 961 97.023 2 572 1 chr4B.!!$F4 570
16 TraesCS6B01G199100 chr4B 156552720 156553291 571 False 957 957 96.853 1 572 1 chr4B.!!$F1 571
17 TraesCS6B01G199100 chr4B 304886725 304887296 571 False 957 957 96.853 1 572 1 chr4B.!!$F5 571
18 TraesCS6B01G199100 chr4B 351486433 351487004 571 True 957 957 96.853 1 572 1 chr4B.!!$R1 571

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
688 689 1.001597 GACTCGTTCCGTGAACTCTGT 60.002 52.381 12.8 9.18 40.05 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2474 2479 7.698836 AAAAGTCATGAACTAACATGCAAAC 57.301 32.0 0.0 0.0 44.79 2.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
180 181 3.309296 TGCTAGAGTTAGGGGGAATGAG 58.691 50.000 0.00 0.00 0.00 2.90
226 227 4.560739 TGATAGTGATGATGAAGGTCCCT 58.439 43.478 0.00 0.00 0.00 4.20
227 228 4.346127 TGATAGTGATGATGAAGGTCCCTG 59.654 45.833 0.00 0.00 0.00 4.45
302 303 4.465305 AGCTGCTATGGAAATTCTTGCTTT 59.535 37.500 0.00 0.00 0.00 3.51
303 304 5.046807 AGCTGCTATGGAAATTCTTGCTTTT 60.047 36.000 0.00 0.00 0.00 2.27
349 350 9.413734 AGAAATTATTAGCTAAATGGAAGCAGT 57.586 29.630 10.85 0.00 42.62 4.40
688 689 1.001597 GACTCGTTCCGTGAACTCTGT 60.002 52.381 12.80 9.18 40.05 3.41
750 751 3.876589 GACCAGGCGGCAGAAACGA 62.877 63.158 13.08 0.00 34.57 3.85
768 769 6.488683 AGAAACGACCAATTTTATTCAGACCA 59.511 34.615 0.00 0.00 0.00 4.02
913 914 3.444805 GAGAGAGAGCACGGCGGT 61.445 66.667 13.24 0.00 0.00 5.68
1113 1114 3.064207 CGTTGATCGAAGGGTTTCTCAA 58.936 45.455 0.00 0.00 42.86 3.02
1193 1194 2.142319 GGCAATTGCACCATTTTCGTT 58.858 42.857 30.32 0.00 44.36 3.85
2174 2176 4.162690 GCGCCTGGGGACTCGAAT 62.163 66.667 15.77 0.00 0.00 3.34
2284 2286 8.001875 AGAAGGTATACATAGTGAGACTGTGAT 58.998 37.037 5.01 0.88 39.34 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
226 227 7.665690 ACAACAGGTAAAACATAATCATTGCA 58.334 30.769 0.00 0.00 0.00 4.08
227 228 8.532977 AACAACAGGTAAAACATAATCATTGC 57.467 30.769 0.00 0.00 0.00 3.56
349 350 8.204836 GGGTTTCATTCTAGCATTAAGAGACTA 58.795 37.037 0.00 0.00 0.00 2.59
750 751 6.165577 GTGCAATGGTCTGAATAAAATTGGT 58.834 36.000 0.00 0.00 0.00 3.67
768 769 3.286751 ACAAGCCACGCGTGCAAT 61.287 55.556 33.17 17.72 41.40 3.56
913 914 1.267574 CCTCCACAGCTAGCTTCCCA 61.268 60.000 16.46 0.00 0.00 4.37
1113 1114 1.337823 CGATTCTGGTTCCTCGGTGTT 60.338 52.381 0.00 0.00 0.00 3.32
1193 1194 1.811965 CATTGCTCAAACATCCCGACA 59.188 47.619 0.00 0.00 0.00 4.35
2474 2479 7.698836 AAAAGTCATGAACTAACATGCAAAC 57.301 32.000 0.00 0.00 44.79 2.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.