Multiple sequence alignment - TraesCS6B01G196400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G196400 chr6B 100.000 3166 0 0 1 3166 232743485 232746650 0.000000e+00 5847
1 TraesCS6B01G196400 chr3A 99.167 2521 15 4 1 2519 424728109 424730625 0.000000e+00 4534
2 TraesCS6B01G196400 chr3A 97.930 628 11 2 2540 3166 704648864 704648238 0.000000e+00 1086
3 TraesCS6B01G196400 chr3A 97.345 339 9 0 2524 2862 459079414 459079752 7.610000e-161 577
4 TraesCS6B01G196400 chr3A 94.969 159 8 0 1 159 363954180 363954338 1.890000e-62 250
5 TraesCS6B01G196400 chr2B 95.782 2513 80 8 1 2507 57499626 57502118 0.000000e+00 4030
6 TraesCS6B01G196400 chr2B 97.551 245 6 0 1 245 57497706 57497950 1.360000e-113 420
7 TraesCS6B01G196400 chr7B 95.668 2516 84 7 1 2510 707913423 707910927 0.000000e+00 4019
8 TraesCS6B01G196400 chr7B 97.086 652 8 2 2515 3166 78119566 78118926 0.000000e+00 1088
9 TraesCS6B01G196400 chr7B 96.515 660 14 7 2515 3166 741263326 741262668 0.000000e+00 1083
10 TraesCS6B01G196400 chr4D 96.091 1663 55 7 858 2515 499725341 499726998 0.000000e+00 2702
11 TraesCS6B01G196400 chr4D 95.775 1657 57 10 858 2507 508479233 508480883 0.000000e+00 2660
12 TraesCS6B01G196400 chr4D 95.175 456 19 2 412 864 499724654 499725109 0.000000e+00 717
13 TraesCS6B01G196400 chr4D 95.165 455 19 2 412 864 508478543 508478996 0.000000e+00 715
14 TraesCS6B01G196400 chr5A 94.341 1661 78 15 858 2507 692551613 692553268 0.000000e+00 2532
15 TraesCS6B01G196400 chr5A 94.220 1661 79 16 858 2507 692545044 692546698 0.000000e+00 2519
16 TraesCS6B01G196400 chr5A 93.640 456 26 2 412 864 692550929 692551384 0.000000e+00 678
17 TraesCS6B01G196400 chr5A 92.982 456 29 2 412 864 692544360 692544815 0.000000e+00 662
18 TraesCS6B01G196400 chr5A 96.552 261 9 0 153 413 245499368 245499108 1.740000e-117 433
19 TraesCS6B01G196400 chr5A 96.124 258 10 0 153 410 329389164 329389421 3.780000e-114 422
20 TraesCS6B01G196400 chr2A 92.512 1656 89 25 864 2507 737417537 737415905 0.000000e+00 2338
21 TraesCS6B01G196400 chr2A 98.363 611 9 1 2556 3166 398876722 398876113 0.000000e+00 1072
22 TraesCS6B01G196400 chr2A 97.448 627 15 1 2541 3166 48842296 48841670 0.000000e+00 1068
23 TraesCS6B01G196400 chr2A 97.287 258 7 0 153 410 178159406 178159663 3.750000e-119 438
24 TraesCS6B01G196400 chr2D 95.271 1311 55 3 858 2161 331545541 331544231 0.000000e+00 2071
25 TraesCS6B01G196400 chr2D 94.714 454 21 2 412 862 331546225 331545772 0.000000e+00 702
26 TraesCS6B01G196400 chr2D 94.350 354 16 4 2159 2511 331544150 331543800 9.990000e-150 540
27 TraesCS6B01G196400 chr6A 89.900 1198 91 13 858 2046 590672721 590671545 0.000000e+00 1515
28 TraesCS6B01G196400 chr7A 97.239 652 16 2 2517 3166 615546677 615547328 0.000000e+00 1103
29 TraesCS6B01G196400 chr7A 94.969 159 8 0 1 159 238535830 238535672 1.890000e-62 250
30 TraesCS6B01G196400 chr1A 96.933 652 13 2 2522 3166 109416968 109417619 0.000000e+00 1086
31 TraesCS6B01G196400 chr1A 97.746 621 13 1 2547 3166 353633533 353632913 0.000000e+00 1068
32 TraesCS6B01G196400 chr1A 96.124 258 10 0 153 410 75390206 75390463 3.780000e-114 422
33 TraesCS6B01G196400 chr4A 99.268 410 2 1 2757 3166 17887386 17886978 0.000000e+00 739
34 TraesCS6B01G196400 chr4A 97.318 261 7 0 153 413 140709029 140708769 8.060000e-121 444
35 TraesCS6B01G196400 chr4A 94.969 159 8 0 1 159 95158094 95158252 1.890000e-62 250
36 TraesCS6B01G196400 chr6D 94.079 456 24 2 412 864 337762390 337762845 0.000000e+00 689
37 TraesCS6B01G196400 chr3B 93.860 456 25 2 412 864 793121286 793121741 0.000000e+00 684
38 TraesCS6B01G196400 chr5B 95.019 261 13 0 153 413 166649366 166649106 8.170000e-111 411
39 TraesCS6B01G196400 chr5D 96.855 159 5 0 1 159 108538603 108538445 1.870000e-67 267
40 TraesCS6B01G196400 chrUn 94.969 159 8 0 1 159 391236841 391236683 1.890000e-62 250
41 TraesCS6B01G196400 chr4B 94.030 67 1 3 2467 2531 1881050 1881115 7.230000e-17 99


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G196400 chr6B 232743485 232746650 3165 False 5847.000000 5847 100.000000 1 3166 1 chr6B.!!$F1 3165
1 TraesCS6B01G196400 chr3A 424728109 424730625 2516 False 4534.000000 4534 99.167000 1 2519 1 chr3A.!!$F2 2518
2 TraesCS6B01G196400 chr3A 704648238 704648864 626 True 1086.000000 1086 97.930000 2540 3166 1 chr3A.!!$R1 626
3 TraesCS6B01G196400 chr2B 57497706 57502118 4412 False 2225.000000 4030 96.666500 1 2507 2 chr2B.!!$F1 2506
4 TraesCS6B01G196400 chr7B 707910927 707913423 2496 True 4019.000000 4019 95.668000 1 2510 1 chr7B.!!$R2 2509
5 TraesCS6B01G196400 chr7B 78118926 78119566 640 True 1088.000000 1088 97.086000 2515 3166 1 chr7B.!!$R1 651
6 TraesCS6B01G196400 chr7B 741262668 741263326 658 True 1083.000000 1083 96.515000 2515 3166 1 chr7B.!!$R3 651
7 TraesCS6B01G196400 chr4D 499724654 499726998 2344 False 1709.500000 2702 95.633000 412 2515 2 chr4D.!!$F1 2103
8 TraesCS6B01G196400 chr4D 508478543 508480883 2340 False 1687.500000 2660 95.470000 412 2507 2 chr4D.!!$F2 2095
9 TraesCS6B01G196400 chr5A 692550929 692553268 2339 False 1605.000000 2532 93.990500 412 2507 2 chr5A.!!$F3 2095
10 TraesCS6B01G196400 chr5A 692544360 692546698 2338 False 1590.500000 2519 93.601000 412 2507 2 chr5A.!!$F2 2095
11 TraesCS6B01G196400 chr2A 737415905 737417537 1632 True 2338.000000 2338 92.512000 864 2507 1 chr2A.!!$R3 1643
12 TraesCS6B01G196400 chr2A 398876113 398876722 609 True 1072.000000 1072 98.363000 2556 3166 1 chr2A.!!$R2 610
13 TraesCS6B01G196400 chr2A 48841670 48842296 626 True 1068.000000 1068 97.448000 2541 3166 1 chr2A.!!$R1 625
14 TraesCS6B01G196400 chr2D 331543800 331546225 2425 True 1104.333333 2071 94.778333 412 2511 3 chr2D.!!$R1 2099
15 TraesCS6B01G196400 chr6A 590671545 590672721 1176 True 1515.000000 1515 89.900000 858 2046 1 chr6A.!!$R1 1188
16 TraesCS6B01G196400 chr7A 615546677 615547328 651 False 1103.000000 1103 97.239000 2517 3166 1 chr7A.!!$F1 649
17 TraesCS6B01G196400 chr1A 109416968 109417619 651 False 1086.000000 1086 96.933000 2522 3166 1 chr1A.!!$F2 644
18 TraesCS6B01G196400 chr1A 353632913 353633533 620 True 1068.000000 1068 97.746000 2547 3166 1 chr1A.!!$R1 619

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
251 2172 2.893489 GGCCTGGTTTTCATGTCTCTTT 59.107 45.455 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2674 4952 6.475207 GTCGCACGTCTATAAAACAATGAAT 58.525 36.0 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 2172 2.893489 GGCCTGGTTTTCATGTCTCTTT 59.107 45.455 0.00 0.0 0.00 2.52
473 2396 9.021807 CCCATTTGATTTCTCATATGAAGCTAT 57.978 33.333 6.90 0.0 40.98 2.97
1398 3573 2.633967 TGCCACTTTTTCCTGCATTCAT 59.366 40.909 0.00 0.0 0.00 2.57
2507 4785 1.336795 GCACGGGCATTTTTGCTAGTT 60.337 47.619 3.77 0.0 40.72 2.24
2511 4789 5.507315 GCACGGGCATTTTTGCTAGTTATAT 60.507 40.000 3.77 0.0 40.72 0.86
2512 4790 6.293735 GCACGGGCATTTTTGCTAGTTATATA 60.294 38.462 3.77 0.0 40.72 0.86
2513 4791 7.574967 GCACGGGCATTTTTGCTAGTTATATAT 60.575 37.037 3.77 0.0 40.72 0.86
2674 4952 2.203280 CCAAATATCGCCGCCCCA 60.203 61.111 0.00 0.0 0.00 4.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2674 4952 6.475207 GTCGCACGTCTATAAAACAATGAAT 58.525 36.0 0.0 0.0 0.0 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.