Multiple sequence alignment - TraesCS6B01G193800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G193800 chr6B 100.000 2567 0 0 1 2567 228757227 228754661 0.000000e+00 4741
1 TraesCS6B01G193800 chr6B 92.811 2615 121 32 1 2567 257782709 257780114 0.000000e+00 3725
2 TraesCS6B01G193800 chr6B 93.879 2271 106 16 1 2258 230602720 230604970 0.000000e+00 3393
3 TraesCS6B01G193800 chr6B 89.028 1039 96 6 1 1027 213521511 213522543 0.000000e+00 1271
4 TraesCS6B01G193800 chr6B 92.236 322 19 4 2249 2565 230604988 230605308 3.890000e-123 451
5 TraesCS6B01G193800 chr6D 94.046 2620 95 21 1 2567 146506942 146509553 0.000000e+00 3917
6 TraesCS6B01G193800 chr6D 93.640 2610 115 30 1 2567 131032540 131029939 0.000000e+00 3853
7 TraesCS6B01G193800 chr6D 93.512 2605 95 24 1 2567 130213320 130210752 0.000000e+00 3807
8 TraesCS6B01G193800 chr6A 95.293 1742 64 2 1 1742 171739101 171740824 0.000000e+00 2747
9 TraesCS6B01G193800 chr6A 96.327 1307 46 1 1 1307 169226384 169225080 0.000000e+00 2146
10 TraesCS6B01G193800 chr6A 93.400 1303 45 15 1303 2567 169221052 169219753 0.000000e+00 1892
11 TraesCS6B01G193800 chr6A 92.062 907 60 4 1 901 162911321 162912221 0.000000e+00 1266
12 TraesCS6B01G193800 chr6A 92.605 622 31 3 1132 1742 162913035 162913652 0.000000e+00 880
13 TraesCS6B01G193800 chr6A 94.314 510 18 5 1760 2258 171740812 171741321 0.000000e+00 771
14 TraesCS6B01G193800 chr6A 84.067 841 87 21 1760 2567 162913640 162914466 0.000000e+00 767
15 TraesCS6B01G193800 chr6A 96.855 318 10 0 2249 2566 171741339 171741656 1.350000e-147 532
16 TraesCS6B01G193800 chr6A 92.308 156 12 0 985 1140 162912224 162912379 3.320000e-54 222
17 TraesCS6B01G193800 chr5B 94.626 1135 49 5 617 1742 84884572 84883441 0.000000e+00 1748
18 TraesCS6B01G193800 chr5B 91.940 670 27 12 1925 2567 84883202 84882533 0.000000e+00 913
19 TraesCS6B01G193800 chr5B 95.364 151 5 1 1760 1910 84883453 84883305 3.300000e-59 239


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G193800 chr6B 228754661 228757227 2566 True 4741.000000 4741 100.000000 1 2567 1 chr6B.!!$R1 2566
1 TraesCS6B01G193800 chr6B 257780114 257782709 2595 True 3725.000000 3725 92.811000 1 2567 1 chr6B.!!$R2 2566
2 TraesCS6B01G193800 chr6B 230602720 230605308 2588 False 1922.000000 3393 93.057500 1 2565 2 chr6B.!!$F2 2564
3 TraesCS6B01G193800 chr6B 213521511 213522543 1032 False 1271.000000 1271 89.028000 1 1027 1 chr6B.!!$F1 1026
4 TraesCS6B01G193800 chr6D 146506942 146509553 2611 False 3917.000000 3917 94.046000 1 2567 1 chr6D.!!$F1 2566
5 TraesCS6B01G193800 chr6D 131029939 131032540 2601 True 3853.000000 3853 93.640000 1 2567 1 chr6D.!!$R2 2566
6 TraesCS6B01G193800 chr6D 130210752 130213320 2568 True 3807.000000 3807 93.512000 1 2567 1 chr6D.!!$R1 2566
7 TraesCS6B01G193800 chr6A 169225080 169226384 1304 True 2146.000000 2146 96.327000 1 1307 1 chr6A.!!$R2 1306
8 TraesCS6B01G193800 chr6A 169219753 169221052 1299 True 1892.000000 1892 93.400000 1303 2567 1 chr6A.!!$R1 1264
9 TraesCS6B01G193800 chr6A 171739101 171741656 2555 False 1350.000000 2747 95.487333 1 2566 3 chr6A.!!$F2 2565
10 TraesCS6B01G193800 chr6A 162911321 162914466 3145 False 783.750000 1266 90.260500 1 2567 4 chr6A.!!$F1 2566
11 TraesCS6B01G193800 chr5B 84882533 84884572 2039 True 966.666667 1748 93.976667 617 2567 3 chr5B.!!$R1 1950

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
60 67 0.182537 CCCCGCAATCCCAATACTCA 59.817 55.0 0.0 0.0 0.0 3.41 F
708 727 1.244019 CCTCCCTTGCAACCTTTCGG 61.244 60.0 0.0 0.0 0.0 4.30 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1196 1880 2.359230 GCTGCGGGCTCTTCAACT 60.359 61.111 0.0 0.0 38.06 3.16 R
1575 2267 2.703536 ACCAGTGTGTGTTACCTGATCA 59.296 45.455 0.0 0.0 32.55 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.032681 GCCCTTCCTGTTCGCTGT 59.967 61.111 0.00 0.0 0.00 4.40
31 32 0.850856 GTTCGCTGTCGACTTTTCGT 59.149 50.000 17.92 0.0 45.43 3.85
39 40 3.926497 GACTTTTCGTCGTCGCCA 58.074 55.556 0.00 0.0 36.96 5.69
60 67 0.182537 CCCCGCAATCCCAATACTCA 59.817 55.000 0.00 0.0 0.00 3.41
66 73 3.365472 GCAATCCCAATACTCACCCTTT 58.635 45.455 0.00 0.0 0.00 3.11
255 274 4.137615 TCCTCCCCGGCGAGATCA 62.138 66.667 17.94 0.0 30.97 2.92
363 382 2.886391 GCTCTTACTCCACTCCTCCACT 60.886 54.545 0.00 0.0 0.00 4.00
537 556 2.036475 CCTTCAGTGCCTGTATCGCTAT 59.964 50.000 2.68 0.0 32.61 2.97
708 727 1.244019 CCTCCCTTGCAACCTTTCGG 61.244 60.000 0.00 0.0 0.00 4.30
1124 1143 2.425668 GCGTTGGCCAAATATACCTTGT 59.574 45.455 22.47 0.0 0.00 3.16
1434 2126 3.429547 CGATCAACCTCGACTCAAAGGAT 60.430 47.826 0.00 0.0 41.12 3.24
1521 2213 8.090788 AGGTTAAAGACAATATCCTTCAGCTA 57.909 34.615 0.00 0.0 0.00 3.32
1575 2267 2.559381 ACCCTCATTAGCTCCAGTCT 57.441 50.000 0.00 0.0 0.00 3.24
1614 2306 4.230964 ACTGGTAAGATCTACCACCTCTCT 59.769 45.833 15.83 0.0 42.21 3.10
1745 2448 8.563123 ACACCTTTTAAATAGGCTTTAGTCTC 57.437 34.615 13.25 0.0 36.17 3.36
1870 2574 4.647399 GCCCCCATAATGCAACTTTTACTA 59.353 41.667 0.00 0.0 0.00 1.82
2113 2918 4.739436 GCCTAAACCAACAACTTTTCCAGG 60.739 45.833 0.00 0.0 0.00 4.45
2164 2997 6.419484 TGAGAGCATTTTCCCTATCGATAA 57.581 37.500 6.58 0.0 0.00 1.75
2176 3009 5.932303 TCCCTATCGATAATTAGCAGTTTGC 59.068 40.000 6.58 0.0 45.46 3.68
2287 3147 7.765695 TCTCTTGCTAAAATTGGATGACTTT 57.234 32.000 0.00 0.0 0.00 2.66
2288 3148 7.596494 TCTCTTGCTAAAATTGGATGACTTTG 58.404 34.615 0.00 0.0 0.00 2.77
2493 3365 8.778358 CCATTTCTTAAGTATCTATTGGCTGAC 58.222 37.037 1.63 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 1.073923 GAGTATTGGGATTGCGGGGAT 59.926 52.381 0.00 0.00 0.00 3.85
210 229 3.535629 CTGGAAGGCACAGACGGCA 62.536 63.158 0.00 0.00 38.20 5.69
708 727 2.228343 AGAAGATTCAGCTTGCTGTTGC 59.772 45.455 20.20 11.39 40.20 4.17
994 1013 5.567423 CGACATCTATGACAGCCATCCATTA 60.567 44.000 0.00 0.00 36.71 1.90
1124 1143 3.194542 CGAGGGGGCAAAATCATAACAAA 59.805 43.478 0.00 0.00 0.00 2.83
1196 1880 2.359230 GCTGCGGGCTCTTCAACT 60.359 61.111 0.00 0.00 38.06 3.16
1326 2010 5.335661 CCAAGCTTGGTATTTGTAGTGGTTC 60.336 44.000 33.46 0.00 43.43 3.62
1521 2213 3.440173 CACCGAACCATCTTGCAGTTAAT 59.560 43.478 0.00 0.00 0.00 1.40
1575 2267 2.703536 ACCAGTGTGTGTTACCTGATCA 59.296 45.455 0.00 0.00 32.55 2.92
1750 2453 9.303116 TCAACCTAAAGCCTATTTTATTCACAA 57.697 29.630 0.00 0.00 0.00 3.33
2085 2889 3.237268 AGTTGTTGGTTTAGGCATGGA 57.763 42.857 0.00 0.00 0.00 3.41
2287 3147 5.549742 AGCCAAAATCATTCAAGGAAACA 57.450 34.783 0.00 0.00 0.00 2.83
2288 3148 7.440856 TGTTAAGCCAAAATCATTCAAGGAAAC 59.559 33.333 0.00 0.00 0.00 2.78
2493 3365 3.165071 AGAAGCCAAACAACCATAAGGG 58.835 45.455 0.00 0.00 44.81 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.