Multiple sequence alignment - TraesCS6B01G172100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G172100 chr6B 100.000 2378 0 0 1 2378 184805779 184808156 0.000000e+00 4392
1 TraesCS6B01G172100 chr4A 93.582 2041 122 5 345 2378 640155815 640153777 0.000000e+00 3035
2 TraesCS6B01G172100 chr4A 74.376 1362 291 45 3 1351 456467684 456466368 1.620000e-146 529
3 TraesCS6B01G172100 chr4A 93.769 321 20 0 1 321 640174215 640174535 1.280000e-132 483
4 TraesCS6B01G172100 chr1A 89.724 2394 215 12 1 2378 492001384 491999006 0.000000e+00 3029
5 TraesCS6B01G172100 chr1A 96.203 948 33 1 1434 2378 575003035 575003982 0.000000e+00 1548
6 TraesCS6B01G172100 chr1A 92.484 612 34 2 1434 2042 575036358 575036960 0.000000e+00 865
7 TraesCS6B01G172100 chr1A 92.333 613 34 3 1434 2042 575076927 575077530 0.000000e+00 859
8 TraesCS6B01G172100 chr3B 97.315 1192 32 0 1187 2378 513943182 513944373 0.000000e+00 2025
9 TraesCS6B01G172100 chr3B 97.072 1093 32 0 1286 2378 661544681 661543589 0.000000e+00 1842
10 TraesCS6B01G172100 chr1B 94.193 861 43 4 1522 2378 266115583 266114726 0.000000e+00 1306
11 TraesCS6B01G172100 chr4D 88.351 1013 103 8 1378 2378 118590139 118589130 0.000000e+00 1203
12 TraesCS6B01G172100 chr4D 87.862 552 61 4 836 1385 118592254 118591707 0.000000e+00 643
13 TraesCS6B01G172100 chr3A 92.985 727 51 0 1652 2378 120813949 120814675 0.000000e+00 1061
14 TraesCS6B01G172100 chr3A 74.229 1362 293 45 3 1351 737275224 737273908 3.500000e-143 518
15 TraesCS6B01G172100 chr3A 83.399 253 42 0 1 253 82459022 82459274 3.950000e-58 235
16 TraesCS6B01G172100 chr7D 93.093 666 45 1 1713 2378 37927818 37927154 0.000000e+00 974
17 TraesCS6B01G172100 chr6D 88.483 547 27 11 610 1150 455718410 455718926 1.550000e-176 628
18 TraesCS6B01G172100 chr5A 74.835 1363 283 47 3 1351 674083114 674081798 1.600000e-156 562
19 TraesCS6B01G172100 chr2A 74.596 1362 288 45 3 1351 293960232 293958916 1.610000e-151 545
20 TraesCS6B01G172100 chr6A 79.002 481 94 6 1 476 52704750 52704272 2.950000e-84 322
21 TraesCS6B01G172100 chr2D 74.581 358 89 2 1 357 632247190 632246834 3.160000e-34 156


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G172100 chr6B 184805779 184808156 2377 False 4392 4392 100.0000 1 2378 1 chr6B.!!$F1 2377
1 TraesCS6B01G172100 chr4A 640153777 640155815 2038 True 3035 3035 93.5820 345 2378 1 chr4A.!!$R2 2033
2 TraesCS6B01G172100 chr4A 456466368 456467684 1316 True 529 529 74.3760 3 1351 1 chr4A.!!$R1 1348
3 TraesCS6B01G172100 chr1A 491999006 492001384 2378 True 3029 3029 89.7240 1 2378 1 chr1A.!!$R1 2377
4 TraesCS6B01G172100 chr1A 575003035 575003982 947 False 1548 1548 96.2030 1434 2378 1 chr1A.!!$F1 944
5 TraesCS6B01G172100 chr1A 575036358 575036960 602 False 865 865 92.4840 1434 2042 1 chr1A.!!$F2 608
6 TraesCS6B01G172100 chr1A 575076927 575077530 603 False 859 859 92.3330 1434 2042 1 chr1A.!!$F3 608
7 TraesCS6B01G172100 chr3B 513943182 513944373 1191 False 2025 2025 97.3150 1187 2378 1 chr3B.!!$F1 1191
8 TraesCS6B01G172100 chr3B 661543589 661544681 1092 True 1842 1842 97.0720 1286 2378 1 chr3B.!!$R1 1092
9 TraesCS6B01G172100 chr1B 266114726 266115583 857 True 1306 1306 94.1930 1522 2378 1 chr1B.!!$R1 856
10 TraesCS6B01G172100 chr4D 118589130 118592254 3124 True 923 1203 88.1065 836 2378 2 chr4D.!!$R1 1542
11 TraesCS6B01G172100 chr3A 120813949 120814675 726 False 1061 1061 92.9850 1652 2378 1 chr3A.!!$F2 726
12 TraesCS6B01G172100 chr3A 737273908 737275224 1316 True 518 518 74.2290 3 1351 1 chr3A.!!$R1 1348
13 TraesCS6B01G172100 chr7D 37927154 37927818 664 True 974 974 93.0930 1713 2378 1 chr7D.!!$R1 665
14 TraesCS6B01G172100 chr6D 455718410 455718926 516 False 628 628 88.4830 610 1150 1 chr6D.!!$F1 540
15 TraesCS6B01G172100 chr5A 674081798 674083114 1316 True 562 562 74.8350 3 1351 1 chr5A.!!$R1 1348
16 TraesCS6B01G172100 chr2A 293958916 293960232 1316 True 545 545 74.5960 3 1351 1 chr2A.!!$R1 1348

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
479 489 0.539051 GCTTCAAGGCTCTGGCTCTA 59.461 55.0 0.0 0.0 37.5 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1436 3025 0.038343 GGCCAAACGCACAACATGAT 60.038 50.0 0.0 0.0 40.31 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 67 1.826921 GGGGTCAGCCTATCGTCGA 60.827 63.158 0.00 0.00 34.45 4.20
118 125 1.417517 TCCATCCATGAAGATCCCACG 59.582 52.381 0.00 0.00 0.00 4.94
121 128 0.617935 TCCATGAAGATCCCACGCAA 59.382 50.000 0.00 0.00 0.00 4.85
310 317 2.733593 AACTCACGAAGCCGCGAC 60.734 61.111 8.23 0.00 39.95 5.19
430 440 0.745845 GTGGCCATCGTTCTGCTGAT 60.746 55.000 9.72 0.00 0.00 2.90
479 489 0.539051 GCTTCAAGGCTCTGGCTCTA 59.461 55.000 0.00 0.00 37.50 2.43
518 528 1.153469 GTGCTAGAGCTGGTGCCTC 60.153 63.158 2.72 0.00 42.66 4.70
554 564 3.775654 CTTCTTCGGGGCGAGGCT 61.776 66.667 0.00 0.00 37.14 4.58
913 924 1.679898 GGTAGGACTGCAGTGCCTT 59.320 57.895 31.80 18.69 37.04 4.35
1180 1193 0.983467 TGGGCAAGATGTCACTGCTA 59.017 50.000 6.94 0.00 0.00 3.49
1484 3074 0.653636 GGTGCTCAACGTGTTTCGAA 59.346 50.000 0.00 0.00 42.86 3.71
1728 3343 0.801872 GTCGTGCCATATTGTGTGCA 59.198 50.000 0.00 0.00 33.49 4.57
1929 3545 4.051167 TCCGGGTGCGAGGGACTA 62.051 66.667 0.00 0.00 41.55 2.59
1932 3548 2.348888 CGGGTGCGAGGGACTAACT 61.349 63.158 0.00 0.00 41.55 2.24
2123 3739 4.396166 CGAAGCAGGATAAACCATTTCAGT 59.604 41.667 0.00 0.00 42.04 3.41
2258 3874 0.881118 CCGATTGGGACACAACCTTG 59.119 55.000 0.00 0.00 42.94 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 82 3.279875 GAATGATCACCCGCCGCC 61.280 66.667 0.00 0.00 0.00 6.13
118 125 0.321653 ACACGATCTTGGGACCTTGC 60.322 55.000 4.03 0.00 0.00 4.01
121 128 0.544357 TGGACACGATCTTGGGACCT 60.544 55.000 4.03 0.00 0.00 3.85
163 170 3.390017 CGCTCGCCGTCGATGATG 61.390 66.667 6.11 0.00 44.56 3.07
164 171 3.583086 TCGCTCGCCGTCGATGAT 61.583 61.111 6.11 0.00 44.56 2.45
284 291 1.498865 CTTCGTGAGTTGTTGCGGCT 61.499 55.000 0.00 0.00 0.00 5.52
310 317 4.175337 ATGCGGTCACCCCATCCG 62.175 66.667 0.00 0.00 45.94 4.18
313 320 2.591753 CTGATGCGGTCACCCCAT 59.408 61.111 0.00 0.00 32.22 4.00
479 489 2.591715 GGCTGCGTCACCACTTGT 60.592 61.111 0.00 0.00 0.00 3.16
518 528 4.421515 CAGGGGAGTGGCCTGCAG 62.422 72.222 6.78 6.78 36.66 4.41
727 737 2.823147 GAGCAGAGCAGGCGCAAT 60.823 61.111 10.83 0.00 42.27 3.56
913 924 1.372997 GTCTTCGAAGAGTGGCGCA 60.373 57.895 27.70 1.15 38.43 6.09
1180 1193 4.699522 GAAAGCGTCCAGGGCGGT 62.700 66.667 13.68 13.68 42.04 5.68
1436 3025 0.038343 GGCCAAACGCACAACATGAT 60.038 50.000 0.00 0.00 40.31 2.45
1484 3074 2.113986 GGCCAGCACCACTCTTGT 59.886 61.111 0.00 0.00 0.00 3.16
1728 3343 3.024547 TGCCGAGCTTAGTCTCTTGTAT 58.975 45.455 0.00 0.00 0.00 2.29
1929 3545 4.803613 GGTCGTGATTTTGAAAAGCAAGTT 59.196 37.500 18.22 0.00 37.87 2.66
1932 3548 3.181495 ACGGTCGTGATTTTGAAAAGCAA 60.181 39.130 10.40 0.00 33.88 3.91
2037 3653 2.036089 GGTTAAAATCACCGGTGGCAAA 59.964 45.455 33.40 15.67 0.00 3.68
2123 3739 0.533531 CACAGCTCTGGAGTGTTGCA 60.534 55.000 1.66 0.00 34.19 4.08
2258 3874 4.700213 AGTGCATTAAGTACATGGGTGTTC 59.300 41.667 0.00 0.00 39.77 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.