Multiple sequence alignment - TraesCS6B01G148800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G148800 chr6B 100.000 2717 0 0 1 2717 149609955 149612671 0.000000e+00 5018.0
1 TraesCS6B01G148800 chr6B 92.609 1150 61 10 719 1860 149550976 149552109 0.000000e+00 1631.0
2 TraesCS6B01G148800 chr6B 96.579 877 19 3 1850 2717 149554207 149555081 0.000000e+00 1443.0
3 TraesCS6B01G148800 chr6B 89.362 658 55 11 715 1362 149576543 149577195 0.000000e+00 813.0
4 TraesCS6B01G148800 chr6B 90.582 584 42 8 1344 1916 149577272 149577853 0.000000e+00 761.0
5 TraesCS6B01G148800 chr6B 84.615 442 48 14 1188 1623 149773521 149773948 3.230000e-114 422.0
6 TraesCS6B01G148800 chr6B 79.491 629 97 18 78 679 716540941 716541564 4.180000e-113 418.0
7 TraesCS6B01G148800 chrUn 98.708 2555 11 2 1 2533 78113502 78110948 0.000000e+00 4516.0
8 TraesCS6B01G148800 chr6D 88.632 1082 95 22 715 1783 75991200 75992266 0.000000e+00 1291.0
9 TraesCS6B01G148800 chr6D 92.206 834 56 9 892 1717 76042684 76043516 0.000000e+00 1171.0
10 TraesCS6B01G148800 chr6D 86.384 448 41 16 1190 1623 76064577 76065018 3.170000e-129 472.0
11 TraesCS6B01G148800 chr6D 80.455 527 73 16 176 676 304689043 304688521 2.550000e-100 375.0
12 TraesCS6B01G148800 chr6A 86.521 1098 89 18 716 1783 91924398 91925466 0.000000e+00 1153.0
13 TraesCS6B01G148800 chr6A 84.650 671 72 18 804 1450 91939321 91939984 8.200000e-180 640.0
14 TraesCS6B01G148800 chr6A 81.186 590 55 22 1446 2033 91967363 91967898 8.990000e-115 424.0
15 TraesCS6B01G148800 chr6A 78.475 590 99 16 117 680 592431295 592431882 7.150000e-96 361.0
16 TraesCS6B01G148800 chr6A 77.508 618 109 22 82 675 284824480 284823869 7.200000e-91 344.0
17 TraesCS6B01G148800 chr6A 96.324 136 4 1 679 813 91939164 91939299 3.520000e-54 222.0
18 TraesCS6B01G148800 chr5D 80.492 610 92 12 96 681 61484851 61485457 2.480000e-120 442.0
19 TraesCS6B01G148800 chr5D 86.755 151 16 4 2148 2294 538668911 538669061 6.020000e-37 165.0
20 TraesCS6B01G148800 chr2A 79.407 641 98 17 70 683 726299950 726299317 3.230000e-114 422.0
21 TraesCS6B01G148800 chr2A 83.594 384 58 4 302 681 723059340 723059722 3.330000e-94 355.0
22 TraesCS6B01G148800 chr2B 79.470 604 96 13 103 681 504207029 504206429 1.170000e-108 403.0
23 TraesCS6B01G148800 chr2B 79.470 151 25 5 2148 2293 717346720 717346571 4.790000e-18 102.0
24 TraesCS6B01G148800 chr4D 79.898 587 87 18 123 683 405721240 405720659 4.210000e-108 401.0
25 TraesCS6B01G148800 chr4D 74.606 571 112 20 83 626 381412477 381413041 1.270000e-53 220.0
26 TraesCS6B01G148800 chr4D 80.114 176 23 8 2148 2321 91074484 91074649 1.320000e-23 121.0
27 TraesCS6B01G148800 chr5B 79.500 600 92 16 107 680 557280709 557280115 5.450000e-107 398.0
28 TraesCS6B01G148800 chr5B 73.835 558 117 20 78 620 122837955 122837412 7.680000e-46 195.0
29 TraesCS6B01G148800 chr5B 79.866 149 25 5 2148 2293 51190375 51190229 1.330000e-18 104.0
30 TraesCS6B01G148800 chr5A 76.849 622 111 24 82 675 677834144 677833528 1.210000e-83 320.0
31 TraesCS6B01G148800 chr5A 75.874 601 118 12 104 679 290729278 290729876 5.730000e-72 281.0
32 TraesCS6B01G148800 chr1D 77.208 566 108 6 110 654 139544212 139543647 7.310000e-81 311.0
33 TraesCS6B01G148800 chr4A 77.563 517 105 6 83 588 10166775 10167291 4.400000e-78 302.0
34 TraesCS6B01G148800 chr4A 80.899 178 25 7 2148 2321 214315022 214314850 6.100000e-27 132.0
35 TraesCS6B01G148800 chr1A 74.667 375 67 15 102 454 345105632 345105264 1.010000e-29 141.0
36 TraesCS6B01G148800 chr3B 79.470 151 26 4 2148 2293 98934406 98934556 4.790000e-18 102.0
37 TraesCS6B01G148800 chr7A 77.901 181 26 8 2148 2321 533939640 533939813 1.720000e-17 100.0
38 TraesCS6B01G148800 chr3D 81.707 82 10 3 2539 2617 135860297 135860218 2.260000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G148800 chr6B 149609955 149612671 2716 False 5018 5018 100.000 1 2717 1 chr6B.!!$F1 2716
1 TraesCS6B01G148800 chr6B 149550976 149555081 4105 False 1537 1631 94.594 719 2717 2 chr6B.!!$F4 1998
2 TraesCS6B01G148800 chr6B 149576543 149577853 1310 False 787 813 89.972 715 1916 2 chr6B.!!$F5 1201
3 TraesCS6B01G148800 chr6B 716540941 716541564 623 False 418 418 79.491 78 679 1 chr6B.!!$F3 601
4 TraesCS6B01G148800 chrUn 78110948 78113502 2554 True 4516 4516 98.708 1 2533 1 chrUn.!!$R1 2532
5 TraesCS6B01G148800 chr6D 75991200 75992266 1066 False 1291 1291 88.632 715 1783 1 chr6D.!!$F1 1068
6 TraesCS6B01G148800 chr6D 76042684 76043516 832 False 1171 1171 92.206 892 1717 1 chr6D.!!$F2 825
7 TraesCS6B01G148800 chr6D 304688521 304689043 522 True 375 375 80.455 176 676 1 chr6D.!!$R1 500
8 TraesCS6B01G148800 chr6A 91924398 91925466 1068 False 1153 1153 86.521 716 1783 1 chr6A.!!$F1 1067
9 TraesCS6B01G148800 chr6A 91939164 91939984 820 False 431 640 90.487 679 1450 2 chr6A.!!$F4 771
10 TraesCS6B01G148800 chr6A 91967363 91967898 535 False 424 424 81.186 1446 2033 1 chr6A.!!$F2 587
11 TraesCS6B01G148800 chr6A 592431295 592431882 587 False 361 361 78.475 117 680 1 chr6A.!!$F3 563
12 TraesCS6B01G148800 chr6A 284823869 284824480 611 True 344 344 77.508 82 675 1 chr6A.!!$R1 593
13 TraesCS6B01G148800 chr5D 61484851 61485457 606 False 442 442 80.492 96 681 1 chr5D.!!$F1 585
14 TraesCS6B01G148800 chr2A 726299317 726299950 633 True 422 422 79.407 70 683 1 chr2A.!!$R1 613
15 TraesCS6B01G148800 chr2B 504206429 504207029 600 True 403 403 79.470 103 681 1 chr2B.!!$R1 578
16 TraesCS6B01G148800 chr4D 405720659 405721240 581 True 401 401 79.898 123 683 1 chr4D.!!$R1 560
17 TraesCS6B01G148800 chr4D 381412477 381413041 564 False 220 220 74.606 83 626 1 chr4D.!!$F2 543
18 TraesCS6B01G148800 chr5B 557280115 557280709 594 True 398 398 79.500 107 680 1 chr5B.!!$R3 573
19 TraesCS6B01G148800 chr5A 677833528 677834144 616 True 320 320 76.849 82 675 1 chr5A.!!$R1 593
20 TraesCS6B01G148800 chr5A 290729278 290729876 598 False 281 281 75.874 104 679 1 chr5A.!!$F1 575
21 TraesCS6B01G148800 chr1D 139543647 139544212 565 True 311 311 77.208 110 654 1 chr1D.!!$R1 544
22 TraesCS6B01G148800 chr4A 10166775 10167291 516 False 302 302 77.563 83 588 1 chr4A.!!$F1 505

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
98 99 4.759793 AAAATTAGGGTTCCTCCACCTT 57.24 40.909 0.0 0.0 36.97 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2470 4812 8.16407 TCACTAGAACTACTATGCCTATCATCA 58.836 37.037 0.0 0.0 36.63 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 4.759793 AAAATTAGGGTTCCTCCACCTT 57.240 40.909 0.00 0.0 36.97 3.50
2470 4812 2.028930 GTGATCCTCTCGTCCAACACTT 60.029 50.000 0.00 0.0 0.00 3.16
2569 4911 3.520290 TCCAACGCTCGATGATACTTT 57.480 42.857 1.07 0.0 0.00 2.66
2625 4967 3.463329 ACACCCTACATAATCCTGCCATT 59.537 43.478 0.00 0.0 0.00 3.16
2684 5026 3.040147 TCCGTCCAAAGAATGACACTC 57.960 47.619 0.00 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 188 6.263168 ACTCGGAAACACATCTGAAAAAGAAT 59.737 34.615 0.00 0.0 38.79 2.40
2470 4812 8.164070 TCACTAGAACTACTATGCCTATCATCA 58.836 37.037 0.00 0.0 36.63 3.07
2654 4996 2.075355 TTTGGACGGAAGGGCCATGT 62.075 55.000 6.18 0.0 39.01 3.21
2684 5026 8.996651 ATTGGAGGGTTATGTTAATTAGGAAG 57.003 34.615 0.00 0.0 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.