Multiple sequence alignment - TraesCS6B01G140900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G140900 chr6B 100.000 3168 0 0 1 3168 140435493 140432326 0.000000e+00 5851
1 TraesCS6B01G140900 chr6B 99.400 3169 14 3 1 3168 140424972 140421808 0.000000e+00 5742
2 TraesCS6B01G140900 chr6B 99.179 3168 19 5 1 3166 140414335 140411173 0.000000e+00 5699
3 TraesCS6B01G140900 chr6B 98.974 2047 11 4 1122 3168 140450962 140448926 0.000000e+00 3655
4 TraesCS6B01G140900 chr6B 81.157 536 94 7 1520 2053 147962399 147962929 1.050000e-114 424
5 TraesCS6B01G140900 chr6B 83.554 377 47 6 1126 1499 147961942 147962306 3.910000e-89 339
6 TraesCS6B01G140900 chr6B 100.000 127 0 0 988 1114 140406669 140406543 5.280000e-58 235
7 TraesCS6B01G140900 chrUn 100.000 1030 0 0 2139 3168 398950424 398949395 0.000000e+00 1903
8 TraesCS6B01G140900 chrUn 90.264 493 38 7 2682 3168 2671951 2671463 1.240000e-178 636
9 TraesCS6B01G140900 chrUn 100.000 127 0 0 988 1114 181264591 181264465 5.280000e-58 235
10 TraesCS6B01G140900 chrUn 100.000 127 0 0 988 1114 413420094 413420220 5.280000e-58 235
11 TraesCS6B01G140900 chr7A 99.291 987 5 2 1 986 693531943 693530958 0.000000e+00 1783
12 TraesCS6B01G140900 chr7A 98.995 995 8 2 1 994 681500676 681501669 0.000000e+00 1781
13 TraesCS6B01G140900 chr7A 96.071 280 9 2 2359 2637 416498685 416498963 3.730000e-124 455
14 TraesCS6B01G140900 chr5B 99.291 987 5 2 1 986 621613988 621614973 0.000000e+00 1783
15 TraesCS6B01G140900 chr5A 99.291 987 5 2 1 986 386219913 386218928 0.000000e+00 1783
16 TraesCS6B01G140900 chr5A 97.445 274 6 1 2361 2633 618474385 618474658 1.720000e-127 466
17 TraesCS6B01G140900 chr5A 100.000 127 0 0 988 1114 457918930 457918804 5.280000e-58 235
18 TraesCS6B01G140900 chr6A 98.994 994 9 1 1 993 129228413 129227420 0.000000e+00 1779
19 TraesCS6B01G140900 chr6A 92.259 1253 73 13 1122 2359 83362621 83363864 0.000000e+00 1755
20 TraesCS6B01G140900 chr6A 81.359 574 95 11 1511 2078 90033590 90034157 1.040000e-124 457
21 TraesCS6B01G140900 chr6A 82.152 381 52 8 1122 1499 90033142 90033509 2.370000e-81 313
22 TraesCS6B01G140900 chr2A 98.703 1002 11 2 1 1001 353963757 353962757 0.000000e+00 1777
23 TraesCS6B01G140900 chr2A 95.189 291 9 5 2359 2648 5434546 5434260 3.730000e-124 455
24 TraesCS6B01G140900 chr2B 98.411 1007 13 3 1 1006 781222589 781223593 0.000000e+00 1768
25 TraesCS6B01G140900 chr6D 92.498 1253 64 18 1122 2359 65389583 65388346 0.000000e+00 1766
26 TraesCS6B01G140900 chr6D 91.356 509 38 3 2666 3168 10706912 10706404 0.000000e+00 691
27 TraesCS6B01G140900 chr6D 82.927 574 87 10 1511 2078 73588891 73589459 1.010000e-139 507
28 TraesCS6B01G140900 chr6D 82.415 381 48 9 1122 1499 73588449 73588813 6.600000e-82 315
29 TraesCS6B01G140900 chr6D 81.365 381 46 11 1122 1499 379721920 379722278 1.440000e-73 287
30 TraesCS6B01G140900 chr7B 90.748 508 41 3 2664 3165 104010998 104010491 0.000000e+00 673
31 TraesCS6B01G140900 chr1B 89.683 504 42 8 2672 3168 109738937 109739437 4.460000e-178 634
32 TraesCS6B01G140900 chr1B 100.000 127 0 0 988 1114 38122587 38122713 5.280000e-58 235
33 TraesCS6B01G140900 chr3B 88.757 507 48 5 2666 3166 302197470 302196967 2.090000e-171 612
34 TraesCS6B01G140900 chr4A 97.445 274 6 1 2361 2633 716768677 716768404 1.720000e-127 466
35 TraesCS6B01G140900 chr4A 100.000 127 0 0 988 1114 378148941 378148815 5.280000e-58 235
36 TraesCS6B01G140900 chr4B 96.774 279 8 1 2357 2634 658966493 658966215 6.190000e-127 464
37 TraesCS6B01G140900 chr1A 100.000 127 0 0 988 1114 65655621 65655747 5.280000e-58 235


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G140900 chr6B 140432326 140435493 3167 True 5851.0 5851 100.0000 1 3168 1 chr6B.!!$R4 3167
1 TraesCS6B01G140900 chr6B 140421808 140424972 3164 True 5742.0 5742 99.4000 1 3168 1 chr6B.!!$R3 3167
2 TraesCS6B01G140900 chr6B 140411173 140414335 3162 True 5699.0 5699 99.1790 1 3166 1 chr6B.!!$R2 3165
3 TraesCS6B01G140900 chr6B 140448926 140450962 2036 True 3655.0 3655 98.9740 1122 3168 1 chr6B.!!$R5 2046
4 TraesCS6B01G140900 chr6B 147961942 147962929 987 False 381.5 424 82.3555 1126 2053 2 chr6B.!!$F1 927
5 TraesCS6B01G140900 chrUn 398949395 398950424 1029 True 1903.0 1903 100.0000 2139 3168 1 chrUn.!!$R3 1029
6 TraesCS6B01G140900 chr7A 693530958 693531943 985 True 1783.0 1783 99.2910 1 986 1 chr7A.!!$R1 985
7 TraesCS6B01G140900 chr7A 681500676 681501669 993 False 1781.0 1781 98.9950 1 994 1 chr7A.!!$F2 993
8 TraesCS6B01G140900 chr5B 621613988 621614973 985 False 1783.0 1783 99.2910 1 986 1 chr5B.!!$F1 985
9 TraesCS6B01G140900 chr5A 386218928 386219913 985 True 1783.0 1783 99.2910 1 986 1 chr5A.!!$R1 985
10 TraesCS6B01G140900 chr6A 129227420 129228413 993 True 1779.0 1779 98.9940 1 993 1 chr6A.!!$R1 992
11 TraesCS6B01G140900 chr6A 83362621 83363864 1243 False 1755.0 1755 92.2590 1122 2359 1 chr6A.!!$F1 1237
12 TraesCS6B01G140900 chr6A 90033142 90034157 1015 False 385.0 457 81.7555 1122 2078 2 chr6A.!!$F2 956
13 TraesCS6B01G140900 chr2A 353962757 353963757 1000 True 1777.0 1777 98.7030 1 1001 1 chr2A.!!$R2 1000
14 TraesCS6B01G140900 chr2B 781222589 781223593 1004 False 1768.0 1768 98.4110 1 1006 1 chr2B.!!$F1 1005
15 TraesCS6B01G140900 chr6D 65388346 65389583 1237 True 1766.0 1766 92.4980 1122 2359 1 chr6D.!!$R2 1237
16 TraesCS6B01G140900 chr6D 10706404 10706912 508 True 691.0 691 91.3560 2666 3168 1 chr6D.!!$R1 502
17 TraesCS6B01G140900 chr6D 73588449 73589459 1010 False 411.0 507 82.6710 1122 2078 2 chr6D.!!$F2 956
18 TraesCS6B01G140900 chr7B 104010491 104010998 507 True 673.0 673 90.7480 2664 3165 1 chr7B.!!$R1 501
19 TraesCS6B01G140900 chr1B 109738937 109739437 500 False 634.0 634 89.6830 2672 3168 1 chr1B.!!$F2 496
20 TraesCS6B01G140900 chr3B 302196967 302197470 503 True 612.0 612 88.7570 2666 3166 1 chr3B.!!$R1 500

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
112 114 2.679450 CGAACAACCTTCGGTACATCA 58.321 47.619 0.0 0.0 38.19 3.07 F
710 713 6.398918 AGCAGAATACTAAACGATCAAGTGT 58.601 36.000 0.0 0.0 0.00 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1898 1991 2.553028 GCATTCTTCACAACCTGGGAGA 60.553 50.00 0.0 0.0 27.75 3.71 R
2927 3039 5.470047 AACGACAAGGAGTAGTTTCATCT 57.530 39.13 0.0 0.0 42.39 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 114 2.679450 CGAACAACCTTCGGTACATCA 58.321 47.619 0.0 0.0 38.19 3.07
710 713 6.398918 AGCAGAATACTAAACGATCAAGTGT 58.601 36.000 0.0 0.0 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
710 713 2.189676 TGACCCATCCCGTTAGCTTAA 58.810 47.619 0.0 0.0 0.00 1.85
1898 1991 2.553028 GCATTCTTCACAACCTGGGAGA 60.553 50.000 0.0 0.0 27.75 3.71
2925 3037 6.197364 ACGACAAGGAGTAGTTTCATCTAG 57.803 41.667 0.0 0.0 31.57 2.43
2926 3038 6.585695 AACGACAAGGAGTAGTTTCATCTA 57.414 37.500 0.0 0.0 42.39 1.98
2927 3039 5.470047 AACGACAAGGAGTAGTTTCATCT 57.530 39.130 0.0 0.0 42.39 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.