Multiple sequence alignment - TraesCS6B01G131900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G131900 chr6B 100.000 3080 0 0 1 3080 128914699 128917778 0 5688
1 TraesCS6B01G131900 chr1B 99.286 3080 21 1 1 3080 683731559 683728481 0 5565
2 TraesCS6B01G131900 chr7B 99.155 3078 25 1 1 3078 698142744 698145820 0 5539
3 TraesCS6B01G131900 chrUn 98.961 3080 30 2 1 3080 40088444 40091521 0 5509
4 TraesCS6B01G131900 chr3B 98.929 3080 32 1 1 3080 92264439 92267517 0 5504
5 TraesCS6B01G131900 chr5B 98.832 3081 34 2 1 3080 713079637 713076558 0 5489
6 TraesCS6B01G131900 chr2A 98.799 3080 35 2 1 3080 563259224 563262301 0 5481
7 TraesCS6B01G131900 chr2A 98.604 3080 42 1 1 3080 735139375 735142453 0 5448


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G131900 chr6B 128914699 128917778 3079 False 5688 5688 100.000 1 3080 1 chr6B.!!$F1 3079
1 TraesCS6B01G131900 chr1B 683728481 683731559 3078 True 5565 5565 99.286 1 3080 1 chr1B.!!$R1 3079
2 TraesCS6B01G131900 chr7B 698142744 698145820 3076 False 5539 5539 99.155 1 3078 1 chr7B.!!$F1 3077
3 TraesCS6B01G131900 chrUn 40088444 40091521 3077 False 5509 5509 98.961 1 3080 1 chrUn.!!$F1 3079
4 TraesCS6B01G131900 chr3B 92264439 92267517 3078 False 5504 5504 98.929 1 3080 1 chr3B.!!$F1 3079
5 TraesCS6B01G131900 chr5B 713076558 713079637 3079 True 5489 5489 98.832 1 3080 1 chr5B.!!$R1 3079
6 TraesCS6B01G131900 chr2A 563259224 563262301 3077 False 5481 5481 98.799 1 3080 1 chr2A.!!$F1 3079
7 TraesCS6B01G131900 chr2A 735139375 735142453 3078 False 5448 5448 98.604 1 3080 1 chr2A.!!$F2 3079

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
792 793 1.47089 GTAAAAATAGTGGCTGCGGCA 59.529 47.619 21.31 10.39 40.87 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2544 2546 0.704076 AACTCCAGCATTTAGGCCCA 59.296 50.0 0.0 0.0 0.0 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 1.532316 TTTCCTGTCCGTCCCGACT 60.532 57.895 0.00 0.00 33.70 4.18
571 572 8.151596 TGGCTATACATACAAATCCATTTACGA 58.848 33.333 0.00 0.00 0.00 3.43
695 696 3.074369 TTCATCGGGAGGCTCGCA 61.074 61.111 28.06 16.84 0.00 5.10
792 793 1.470890 GTAAAAATAGTGGCTGCGGCA 59.529 47.619 21.31 10.39 40.87 5.69
1062 1063 9.685276 ATGATGACCACTTTTTGTATTATCTCA 57.315 29.630 0.00 0.00 0.00 3.27
2214 2216 4.788075 TCTGAACCTGGAATCAAAGGGATA 59.212 41.667 0.00 0.00 37.94 2.59
2230 2232 5.319043 AGGGATATGCGAAAGGGATTTTA 57.681 39.130 0.00 0.00 0.00 1.52
2257 2259 7.893658 AGAATCTTACGTCCTTGAGAAAAGTA 58.106 34.615 0.00 0.00 0.00 2.24
2337 2339 9.120658 AGATTGAATATAGGGAGGAATGAATCA 57.879 33.333 0.00 0.00 0.00 2.57
2544 2546 3.663198 AGCTTGAGGACCCATTCTATCT 58.337 45.455 0.00 0.00 0.00 1.98
2728 2730 8.826710 CGATATAGGTTGCTTTTTGATGACTAA 58.173 33.333 0.00 0.00 0.00 2.24
2885 2887 3.822735 CAGAAAGGGATGAAACTGAGCAA 59.177 43.478 0.00 0.00 0.00 3.91
2937 2939 6.180472 TCCAGATTATTTCAGAACTCCAACC 58.820 40.000 0.00 0.00 0.00 3.77
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 2.431683 GAGACCCAACTGCTGCCA 59.568 61.111 0.00 0.0 0.00 4.92
571 572 6.169094 CAGTTCCAATCGGAGCATATAGATT 58.831 40.000 0.00 0.0 44.68 2.40
695 696 7.255001 CCTTTTGGAGTTGACGTAACAAACTAT 60.255 37.037 0.00 0.0 44.07 2.12
792 793 0.249741 CAAAGGTTGACCCTCGACGT 60.250 55.000 0.00 0.0 45.47 4.34
866 867 5.964477 AGGGATGGTCAGTGAACTTCTATTA 59.036 40.000 20.06 0.0 0.00 0.98
1082 1083 6.562640 GCGAAAAGTGACGTTGTGATTACTTA 60.563 38.462 0.00 0.0 0.00 2.24
1442 1444 6.999950 TCCCGCATTAAGATATTAGCTAACA 58.000 36.000 8.70 0.0 0.00 2.41
2214 2216 7.410120 AGATTCTTTAAAATCCCTTTCGCAT 57.590 32.000 0.00 0.0 36.49 4.73
2230 2232 7.715686 ACTTTTCTCAAGGACGTAAGATTCTTT 59.284 33.333 3.86 0.0 43.62 2.52
2337 2339 4.301072 TGCCTTAGTTTACTTGATGCCT 57.699 40.909 0.00 0.0 0.00 4.75
2544 2546 0.704076 AACTCCAGCATTTAGGCCCA 59.296 50.000 0.00 0.0 0.00 5.36
2937 2939 6.317857 TCAGATTCGAGTATAGCATCATTCG 58.682 40.000 0.00 0.0 0.00 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.