Multiple sequence alignment - TraesCS6B01G131700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G131700 chr6B 100.000 3161 0 0 1 3161 128892189 128889029 0 5838
1 TraesCS6B01G131700 chr7B 98.895 3167 29 2 1 3161 716798050 716794884 0 5650
2 TraesCS6B01G131700 chr7B 98.484 3166 32 4 1 3161 742935280 742938434 0 5566
3 TraesCS6B01G131700 chr7B 96.607 3183 85 8 1 3161 47217226 47220407 0 5258
4 TraesCS6B01G131700 chr7B 96.191 3177 84 8 1 3161 139621814 139618659 0 5162
5 TraesCS6B01G131700 chr5B 98.895 3166 28 3 1 3161 713115172 713112009 0 5646
6 TraesCS6B01G131700 chr5B 98.610 3166 38 2 1 3161 713093555 713096719 0 5598
7 TraesCS6B01G131700 chr5B 98.330 2276 25 4 1 2270 127821205 127818937 0 3980
8 TraesCS6B01G131700 chr1B 98.547 3166 40 2 1 3161 583548099 583551263 0 5587
9 TraesCS6B01G131700 chr1B 97.103 3176 67 8 1 3161 49787131 49783966 0 5332
10 TraesCS6B01G131700 chr1B 96.985 3184 67 10 1 3161 49815624 49818801 0 5321
11 TraesCS6B01G131700 chr7A 98.712 2252 24 4 913 3161 60097493 60095244 0 3993


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G131700 chr6B 128889029 128892189 3160 True 5838 5838 100.000 1 3161 1 chr6B.!!$R1 3160
1 TraesCS6B01G131700 chr7B 716794884 716798050 3166 True 5650 5650 98.895 1 3161 1 chr7B.!!$R2 3160
2 TraesCS6B01G131700 chr7B 742935280 742938434 3154 False 5566 5566 98.484 1 3161 1 chr7B.!!$F2 3160
3 TraesCS6B01G131700 chr7B 47217226 47220407 3181 False 5258 5258 96.607 1 3161 1 chr7B.!!$F1 3160
4 TraesCS6B01G131700 chr7B 139618659 139621814 3155 True 5162 5162 96.191 1 3161 1 chr7B.!!$R1 3160
5 TraesCS6B01G131700 chr5B 713112009 713115172 3163 True 5646 5646 98.895 1 3161 1 chr5B.!!$R2 3160
6 TraesCS6B01G131700 chr5B 713093555 713096719 3164 False 5598 5598 98.610 1 3161 1 chr5B.!!$F1 3160
7 TraesCS6B01G131700 chr5B 127818937 127821205 2268 True 3980 3980 98.330 1 2270 1 chr5B.!!$R1 2269
8 TraesCS6B01G131700 chr1B 583548099 583551263 3164 False 5587 5587 98.547 1 3161 1 chr1B.!!$F2 3160
9 TraesCS6B01G131700 chr1B 49783966 49787131 3165 True 5332 5332 97.103 1 3161 1 chr1B.!!$R1 3160
10 TraesCS6B01G131700 chr1B 49815624 49818801 3177 False 5321 5321 96.985 1 3161 1 chr1B.!!$F1 3160
11 TraesCS6B01G131700 chr7A 60095244 60097493 2249 True 3993 3993 98.712 913 3161 1 chr7A.!!$R1 2248

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
544 551 0.608308 AACTACCTTTGCCCGCCTTC 60.608 55.0 0.0 0.0 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2334 2365 3.251479 TGTTCATCGGGAAGTGATCTG 57.749 47.619 0.0 0.0 35.82 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
544 551 0.608308 AACTACCTTTGCCCGCCTTC 60.608 55.000 0.00 0.0 0.00 3.46
1072 1090 7.598278 TGCTATTACAACGAATCAACCAATTT 58.402 30.769 0.00 0.0 0.00 1.82
2334 2365 6.543430 AGAATGTCATATATCTCAGGAGCC 57.457 41.667 0.00 0.0 0.00 4.70
2805 2837 5.728351 TTTTTCGTTCGATGTCTTGAACT 57.272 34.783 3.92 0.0 41.74 3.01
2935 2968 2.817396 GCGACAGCTTCTGCCTCC 60.817 66.667 0.00 0.0 40.80 4.30
3064 3102 9.976511 TGTACTAATTAATGTGTATGGTCTAGC 57.023 33.333 0.00 0.0 0.00 3.42
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
544 551 3.718956 AGGGGGAATGGATTCTACAAGAG 59.281 47.826 0.00 0.0 37.00 2.85
1072 1090 3.256631 GGAAGACGGGAACACTTACTACA 59.743 47.826 0.00 0.0 0.00 2.74
1710 1739 6.543465 TGAGAAAATGACTTGTCACTGTGAAT 59.457 34.615 12.81 0.0 0.00 2.57
2050 2081 3.802948 AGCTACACCTAATTCCAGACG 57.197 47.619 0.00 0.0 0.00 4.18
2334 2365 3.251479 TGTTCATCGGGAAGTGATCTG 57.749 47.619 0.00 0.0 35.82 2.90
2413 2445 6.072649 TCCCACTGATACCTAATCGATAACA 58.927 40.000 0.00 0.0 37.42 2.41
2935 2968 0.930742 GAGCGATAGTGAAGCCGTCG 60.931 60.000 0.00 0.0 39.35 5.12
3064 3102 1.006400 AGGAAGGAGGCATTGGAAAGG 59.994 52.381 0.00 0.0 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.