Multiple sequence alignment - TraesCS6B01G125300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G125300 chr6B 100.000 2648 0 0 1 2648 120534334 120531687 0.000000e+00 4891.0
1 TraesCS6B01G125300 chr6B 86.266 1580 163 28 666 2220 296847929 296849479 0.000000e+00 1666.0
2 TraesCS6B01G125300 chr6B 91.964 448 36 0 2 449 296846593 296847040 1.730000e-176 628.0
3 TraesCS6B01G125300 chr1D 93.544 2184 109 12 1 2169 83055933 83053767 0.000000e+00 3223.0
4 TraesCS6B01G125300 chr1D 93.452 504 27 6 2147 2648 83053611 83053112 0.000000e+00 743.0
5 TraesCS6B01G125300 chr7A 92.216 2184 129 22 1 2169 247703404 247701247 0.000000e+00 3053.0
6 TraesCS6B01G125300 chr7A 94.433 503 20 7 2147 2648 247701109 247700614 0.000000e+00 767.0
7 TraesCS6B01G125300 chr5A 91.066 2261 140 28 1 2220 190546091 190548330 0.000000e+00 3000.0
8 TraesCS6B01G125300 chr5A 93.837 503 25 5 2144 2644 190548912 190549410 0.000000e+00 752.0
9 TraesCS6B01G125300 chr5A 90.667 75 3 3 2147 2220 190548803 190548874 2.170000e-16 97.1
10 TraesCS6B01G125300 chr4B 98.296 1643 19 2 1 1634 32575608 32573966 0.000000e+00 2870.0
11 TraesCS6B01G125300 chr4B 98.124 1013 16 2 1636 2648 32571054 32570045 0.000000e+00 1762.0
12 TraesCS6B01G125300 chr4B 97.927 1013 18 2 1636 2648 32569019 32568010 0.000000e+00 1751.0
13 TraesCS6B01G125300 chr5B 98.442 1412 18 2 1 1408 697757450 697758861 0.000000e+00 2483.0
14 TraesCS6B01G125300 chr1B 92.731 1362 73 15 819 2169 82550344 82548998 0.000000e+00 1943.0
15 TraesCS6B01G125300 chr1B 95.238 735 35 0 1 735 82551481 82550747 0.000000e+00 1164.0
16 TraesCS6B01G125300 chr2A 83.269 1297 167 27 958 2227 297541944 297540671 0.000000e+00 1147.0
17 TraesCS6B01G125300 chr2A 89.655 551 48 7 2101 2648 58201820 58201276 0.000000e+00 693.0
18 TraesCS6B01G125300 chr1A 83.128 1298 167 25 952 2219 84819346 84820621 0.000000e+00 1136.0
19 TraesCS6B01G125300 chr4A 83.075 1288 173 27 958 2219 618794691 618793423 0.000000e+00 1129.0
20 TraesCS6B01G125300 chr4A 90.018 551 46 7 2101 2648 109516223 109516767 0.000000e+00 704.0
21 TraesCS6B01G125300 chr4A 89.474 551 50 8 2101 2648 610971802 610972347 0.000000e+00 689.0
22 TraesCS6B01G125300 chr7B 90.036 552 44 9 2101 2648 258334207 258333663 0.000000e+00 704.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G125300 chr6B 120531687 120534334 2647 True 4891.000000 4891 100.000000 1 2648 1 chr6B.!!$R1 2647
1 TraesCS6B01G125300 chr6B 296846593 296849479 2886 False 1147.000000 1666 89.115000 2 2220 2 chr6B.!!$F1 2218
2 TraesCS6B01G125300 chr1D 83053112 83055933 2821 True 1983.000000 3223 93.498000 1 2648 2 chr1D.!!$R1 2647
3 TraesCS6B01G125300 chr7A 247700614 247703404 2790 True 1910.000000 3053 93.324500 1 2648 2 chr7A.!!$R1 2647
4 TraesCS6B01G125300 chr5A 190546091 190549410 3319 False 1283.033333 3000 91.856667 1 2644 3 chr5A.!!$F1 2643
5 TraesCS6B01G125300 chr4B 32568010 32575608 7598 True 2127.666667 2870 98.115667 1 2648 3 chr4B.!!$R1 2647
6 TraesCS6B01G125300 chr5B 697757450 697758861 1411 False 2483.000000 2483 98.442000 1 1408 1 chr5B.!!$F1 1407
7 TraesCS6B01G125300 chr1B 82548998 82551481 2483 True 1553.500000 1943 93.984500 1 2169 2 chr1B.!!$R1 2168
8 TraesCS6B01G125300 chr2A 297540671 297541944 1273 True 1147.000000 1147 83.269000 958 2227 1 chr2A.!!$R2 1269
9 TraesCS6B01G125300 chr2A 58201276 58201820 544 True 693.000000 693 89.655000 2101 2648 1 chr2A.!!$R1 547
10 TraesCS6B01G125300 chr1A 84819346 84820621 1275 False 1136.000000 1136 83.128000 952 2219 1 chr1A.!!$F1 1267
11 TraesCS6B01G125300 chr4A 618793423 618794691 1268 True 1129.000000 1129 83.075000 958 2219 1 chr4A.!!$R1 1261
12 TraesCS6B01G125300 chr4A 109516223 109516767 544 False 704.000000 704 90.018000 2101 2648 1 chr4A.!!$F1 547
13 TraesCS6B01G125300 chr4A 610971802 610972347 545 False 689.000000 689 89.474000 2101 2648 1 chr4A.!!$F2 547
14 TraesCS6B01G125300 chr7B 258333663 258334207 544 True 704.000000 704 90.036000 2101 2648 1 chr7B.!!$R1 547

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
968 1962 1.423541 TCCATTGCAAGGTGGTACAGT 59.576 47.619 16.75 0.0 41.8 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2378 8898 0.461339 ATGTTACACGACGGATGGGC 60.461 55.0 0.0 0.0 0.0 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
242 244 3.389925 TTACCCCACACGTACTCTTTG 57.610 47.619 0.00 0.00 0.00 2.77
968 1962 1.423541 TCCATTGCAAGGTGGTACAGT 59.576 47.619 16.75 0.00 41.80 3.55
1143 2140 3.659786 TCAACGTCGTGAGATTTTCCAT 58.340 40.909 0.00 0.00 45.19 3.41
1162 2159 0.605083 TGCAGTTCGATCTGTGCTCT 59.395 50.000 21.39 0.00 37.70 4.09
1210 2207 2.425592 CTGTCCGCACAGGTTGGA 59.574 61.111 0.00 0.00 45.75 3.53
1584 2582 5.050490 GCTCTTAAGGCGAAGATATCAACA 58.950 41.667 5.32 0.00 34.95 3.33
1710 5625 6.978338 ACACTTTCAGACTTACATAAGACGA 58.022 36.000 5.66 0.16 37.08 4.20
2045 5974 4.834496 TGAGAATTTGGAGCCACTTCATTT 59.166 37.500 11.47 0.00 0.00 2.32
2211 8730 6.326583 CCCAGTTTATACTCTTGAGGGTATGA 59.673 42.308 12.68 3.01 31.18 2.15
2374 8894 1.740025 CTCCCATTTTGGCTCGAACTC 59.260 52.381 0.00 0.00 35.79 3.01
2378 8898 1.394917 CATTTTGGCTCGAACTCTCCG 59.605 52.381 0.00 0.00 0.00 4.63
2505 9026 2.427095 GCCTGATACGCCTCCAAATTTT 59.573 45.455 0.00 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
242 244 9.874205 CCTTTATGATAAAGAGATCATCCTCTC 57.126 37.037 22.85 0.00 43.88 3.20
373 375 2.559705 GGGGTTCCATGGAAGGTTCATT 60.560 50.000 27.73 0.00 34.49 2.57
968 1962 5.593095 TCGCCACTAAGATTAGAAGCTTCTA 59.407 40.000 28.47 28.47 38.70 2.10
1143 2140 0.605083 AGAGCACAGATCGAACTGCA 59.395 50.000 21.27 0.00 41.06 4.41
1162 2159 0.535335 GGAGCAGTATCACCAACCGA 59.465 55.000 0.00 0.00 0.00 4.69
1349 2347 5.264395 TCTCCAACACAGATGACATCTCTA 58.736 41.667 15.24 0.00 37.58 2.43
1584 2582 1.205893 GACTCGGCTTCATTCTCCAGT 59.794 52.381 0.00 0.00 0.00 4.00
1689 5599 6.387465 TGGTCGTCTTATGTAAGTCTGAAAG 58.613 40.000 0.16 0.00 34.93 2.62
2145 6098 5.899299 ACTCCAACGCTTACGAGTATAAAT 58.101 37.500 0.00 0.00 43.93 1.40
2176 8695 1.616159 ATAAACTGGGGCACACACAC 58.384 50.000 0.00 0.00 0.00 3.82
2374 8894 4.873129 CACGACGGATGGGCGGAG 62.873 72.222 0.00 0.00 0.00 4.63
2378 8898 0.461339 ATGTTACACGACGGATGGGC 60.461 55.000 0.00 0.00 0.00 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.