Multiple sequence alignment - TraesCS6B01G112500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G112500 chr6B 100.000 2177 0 0 1 2177 94820126 94817950 0.000000e+00 4021.0
1 TraesCS6B01G112500 chr6B 98.209 2177 35 3 1 2177 94902058 94899886 0.000000e+00 3801.0
2 TraesCS6B01G112500 chr6B 92.647 68 4 1 834 901 641450333 641450399 1.780000e-16 97.1
3 TraesCS6B01G112500 chr6D 98.337 1203 20 0 888 2090 389254036 389252834 0.000000e+00 2111.0
4 TraesCS6B01G112500 chr5D 98.254 1203 21 0 888 2090 503237894 503236692 0.000000e+00 2106.0
5 TraesCS6B01G112500 chr5D 98.254 1203 20 1 888 2090 503242142 503240941 0.000000e+00 2104.0
6 TraesCS6B01G112500 chr5D 95.606 842 31 6 1 839 551284553 551285391 0.000000e+00 1345.0
7 TraesCS6B01G112500 chr3A 98.171 1203 21 1 888 2090 66008265 66009466 0.000000e+00 2098.0
8 TraesCS6B01G112500 chr3A 95.838 841 29 5 1 839 31886059 31886895 0.000000e+00 1354.0
9 TraesCS6B01G112500 chrUn 98.088 1203 20 1 888 2090 216509252 216510451 0.000000e+00 2091.0
10 TraesCS6B01G112500 chrUn 98.005 1203 24 0 888 2090 397077438 397078640 0.000000e+00 2089.0
11 TraesCS6B01G112500 chr3B 97.922 1203 24 1 888 2090 201536387 201535186 0.000000e+00 2082.0
12 TraesCS6B01G112500 chr1D 97.839 1203 26 0 888 2090 176206607 176205405 0.000000e+00 2078.0
13 TraesCS6B01G112500 chr1D 95.957 841 28 5 1 839 299667665 299668501 0.000000e+00 1360.0
14 TraesCS6B01G112500 chr2D 95.962 842 27 6 1 839 124508769 124509606 0.000000e+00 1360.0
15 TraesCS6B01G112500 chr2D 95.838 841 27 5 1 839 73040433 73039599 0.000000e+00 1352.0
16 TraesCS6B01G112500 chr7D 95.848 843 26 9 1 839 69766162 69766999 0.000000e+00 1354.0
17 TraesCS6B01G112500 chr4D 95.724 842 28 7 1 839 449156203 449155367 0.000000e+00 1349.0
18 TraesCS6B01G112500 chr3D 95.719 841 31 5 1 839 609451273 609452110 0.000000e+00 1349.0
19 TraesCS6B01G112500 chr2B 100.000 88 0 0 2090 2177 237461009 237461096 1.730000e-36 163.0
20 TraesCS6B01G112500 chr5B 100.000 87 0 0 2091 2177 128313174 128313260 6.220000e-36 161.0
21 TraesCS6B01G112500 chr5B 100.000 87 0 0 2091 2177 213846547 213846633 6.220000e-36 161.0
22 TraesCS6B01G112500 chr4B 100.000 87 0 0 2091 2177 223255034 223254948 6.220000e-36 161.0
23 TraesCS6B01G112500 chr4B 100.000 87 0 0 2091 2177 246339472 246339386 6.220000e-36 161.0
24 TraesCS6B01G112500 chr4B 100.000 87 0 0 2091 2177 328306939 328306853 6.220000e-36 161.0
25 TraesCS6B01G112500 chr4B 100.000 87 0 0 2091 2177 378992482 378992568 6.220000e-36 161.0
26 TraesCS6B01G112500 chr4B 100.000 87 0 0 2091 2177 522453923 522453837 6.220000e-36 161.0
27 TraesCS6B01G112500 chr1B 90.667 75 6 1 827 901 470373237 470373164 4.950000e-17 99.0
28 TraesCS6B01G112500 chr7B 93.846 65 3 1 837 901 239897064 239897001 1.780000e-16 97.1
29 TraesCS6B01G112500 chr7B 89.333 75 6 2 827 901 216460295 216460223 2.300000e-15 93.5
30 TraesCS6B01G112500 chr7B 89.333 75 6 2 827 901 301967091 301967163 2.300000e-15 93.5
31 TraesCS6B01G112500 chr7A 98.077 52 1 0 837 888 600369903 600369852 8.280000e-15 91.6
32 TraesCS6B01G112500 chr4A 90.769 65 5 1 837 901 651513413 651513350 3.850000e-13 86.1
33 TraesCS6B01G112500 chr4A 90.625 64 5 1 838 901 716178344 716178282 1.380000e-12 84.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G112500 chr6B 94817950 94820126 2176 True 4021 4021 100.000 1 2177 1 chr6B.!!$R1 2176
1 TraesCS6B01G112500 chr6B 94899886 94902058 2172 True 3801 3801 98.209 1 2177 1 chr6B.!!$R2 2176
2 TraesCS6B01G112500 chr6D 389252834 389254036 1202 True 2111 2111 98.337 888 2090 1 chr6D.!!$R1 1202
3 TraesCS6B01G112500 chr5D 503236692 503242142 5450 True 2105 2106 98.254 888 2090 2 chr5D.!!$R1 1202
4 TraesCS6B01G112500 chr5D 551284553 551285391 838 False 1345 1345 95.606 1 839 1 chr5D.!!$F1 838
5 TraesCS6B01G112500 chr3A 66008265 66009466 1201 False 2098 2098 98.171 888 2090 1 chr3A.!!$F2 1202
6 TraesCS6B01G112500 chr3A 31886059 31886895 836 False 1354 1354 95.838 1 839 1 chr3A.!!$F1 838
7 TraesCS6B01G112500 chrUn 216509252 216510451 1199 False 2091 2091 98.088 888 2090 1 chrUn.!!$F1 1202
8 TraesCS6B01G112500 chrUn 397077438 397078640 1202 False 2089 2089 98.005 888 2090 1 chrUn.!!$F2 1202
9 TraesCS6B01G112500 chr3B 201535186 201536387 1201 True 2082 2082 97.922 888 2090 1 chr3B.!!$R1 1202
10 TraesCS6B01G112500 chr1D 176205405 176206607 1202 True 2078 2078 97.839 888 2090 1 chr1D.!!$R1 1202
11 TraesCS6B01G112500 chr1D 299667665 299668501 836 False 1360 1360 95.957 1 839 1 chr1D.!!$F1 838
12 TraesCS6B01G112500 chr2D 124508769 124509606 837 False 1360 1360 95.962 1 839 1 chr2D.!!$F1 838
13 TraesCS6B01G112500 chr2D 73039599 73040433 834 True 1352 1352 95.838 1 839 1 chr2D.!!$R1 838
14 TraesCS6B01G112500 chr7D 69766162 69766999 837 False 1354 1354 95.848 1 839 1 chr7D.!!$F1 838
15 TraesCS6B01G112500 chr4D 449155367 449156203 836 True 1349 1349 95.724 1 839 1 chr4D.!!$R1 838
16 TraesCS6B01G112500 chr3D 609451273 609452110 837 False 1349 1349 95.719 1 839 1 chr3D.!!$F1 838

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
965 4327 9.533831 AGGAACACATACAAGAAAAAGGATAAT 57.466 29.63 0.0 0.0 0.0 1.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1864 5227 2.047061 TCTCGGTATCAATCCCCTTGG 58.953 52.381 0.0 0.0 35.43 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
965 4327 9.533831 AGGAACACATACAAGAAAAAGGATAAT 57.466 29.630 0.00 0.00 0.00 1.28
1054 4416 7.039223 TCCTACCGAGACAGAATTTAGAACTTT 60.039 37.037 0.00 0.00 0.00 2.66
1411 4773 6.816140 TCGAAATTGAAAAGAACTGCCTTTTT 59.184 30.769 8.94 0.00 43.90 1.94
1705 5067 7.398332 AGGAAAAGGTTCTCTATTGATGCAAAT 59.602 33.333 0.00 0.00 33.92 2.32
1709 5071 6.359804 AGGTTCTCTATTGATGCAAATGCTA 58.640 36.000 6.97 0.00 42.66 3.49
1845 5208 5.247564 TGGAAACTCGAAAAGGATCCTTCTA 59.752 40.000 27.20 11.80 35.77 2.10
1935 5301 8.407832 TGATTTGATCTGCATATGTTTGGTAAG 58.592 33.333 4.29 0.00 0.00 2.34
2018 5384 4.750098 ACGTGACTCAATTGGTCTTAGTTG 59.250 41.667 20.58 8.54 35.04 3.16
2109 5475 5.954757 TGACTTACCCCTTTTGGATGTTTA 58.045 37.500 0.00 0.00 44.07 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
661 666 7.750229 ATGGACTATCGCATTATCAACATTT 57.250 32.000 0.00 0.00 0.00 2.32
662 667 7.750229 AATGGACTATCGCATTATCAACATT 57.250 32.000 0.00 0.00 0.00 2.71
1054 4416 8.232412 TCTTTGCCTATTAGGTAAGAGGATAGA 58.768 37.037 13.52 12.59 45.22 1.98
1065 4427 5.430089 AGAGGTCAATCTTTGCCTATTAGGT 59.570 40.000 11.38 0.00 37.80 3.08
1411 4773 7.553334 AGCAATAGAACGAGGAAAGTATACAA 58.447 34.615 5.50 0.00 0.00 2.41
1442 4804 1.645034 CGATCGATTGCACAAGACCT 58.355 50.000 10.26 0.00 0.00 3.85
1449 4811 5.582550 TCTATATGATCCGATCGATTGCAC 58.417 41.667 18.66 2.47 0.00 4.57
1705 5067 7.147195 TCTATCCCTATCCTCTAGGTATAGCA 58.853 42.308 4.48 0.00 35.09 3.49
1709 5071 6.779578 TCCTCTATCCCTATCCTCTAGGTAT 58.220 44.000 0.00 0.00 36.34 2.73
1864 5227 2.047061 TCTCGGTATCAATCCCCTTGG 58.953 52.381 0.00 0.00 35.43 3.61
2018 5384 2.572284 CACTCCGTCCCGAAGACC 59.428 66.667 0.67 0.00 43.08 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.