Multiple sequence alignment - TraesCS6B01G106300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G106300 chr6B 100.000 3293 0 0 1 3293 86646466 86649758 0.000000e+00 6082.0
1 TraesCS6B01G106300 chr6B 96.177 1805 68 1 719 2522 86447048 86445244 0.000000e+00 2950.0
2 TraesCS6B01G106300 chr6B 95.585 1812 72 3 719 2522 86673038 86671227 0.000000e+00 2896.0
3 TraesCS6B01G106300 chr6B 98.444 771 12 0 2523 3293 86567015 86566245 0.000000e+00 1358.0
4 TraesCS6B01G106300 chr6B 90.291 1030 78 10 1236 2251 87331036 87330015 0.000000e+00 1328.0
5 TraesCS6B01G106300 chr6B 93.462 413 23 4 720 1130 87331473 87331063 7.810000e-171 610.0
6 TraesCS6B01G106300 chr6B 79.817 763 80 33 19 718 42485654 42484903 3.820000e-134 488.0
7 TraesCS6B01G106300 chr6B 87.004 454 23 16 300 719 712296235 712295784 2.300000e-131 479.0
8 TraesCS6B01G106300 chr6B 79.515 742 85 36 19 722 617201927 617201215 1.790000e-127 466.0
9 TraesCS6B01G106300 chr6B 94.510 255 12 2 1 253 712296488 712296234 3.080000e-105 392.0
10 TraesCS6B01G106300 chr6D 93.600 1797 93 11 720 2511 37117878 37116099 0.000000e+00 2662.0
11 TraesCS6B01G106300 chr6D 91.162 1007 65 9 1387 2385 37226543 37225553 0.000000e+00 1345.0
12 TraesCS6B01G106300 chr6D 91.543 674 50 4 720 1392 37229037 37228370 0.000000e+00 922.0
13 TraesCS6B01G106300 chr6D 91.446 643 51 3 2652 3293 82567602 82568241 0.000000e+00 880.0
14 TraesCS6B01G106300 chr6D 92.857 224 16 0 722 945 37337611 37337388 3.170000e-85 326.0
15 TraesCS6B01G106300 chr6D 93.284 134 6 3 2521 2653 82563713 82563844 9.320000e-46 195.0
16 TraesCS6B01G106300 chr6A 93.987 1530 88 3 720 2248 48641838 48640312 0.000000e+00 2313.0
17 TraesCS6B01G106300 chr6A 87.671 73 9 0 647 719 421202707 421202779 5.850000e-13 86.1
18 TraesCS6B01G106300 chr4A 97.925 771 16 0 2523 3293 69983738 69984508 0.000000e+00 1336.0
19 TraesCS6B01G106300 chr4A 79.759 1492 223 49 762 2237 713605992 713604564 0.000000e+00 1009.0
20 TraesCS6B01G106300 chr4B 97.793 725 10 2 1 719 576112070 576111346 0.000000e+00 1245.0
21 TraesCS6B01G106300 chr4B 87.682 755 40 25 1 718 389692584 389691846 0.000000e+00 830.0
22 TraesCS6B01G106300 chr1A 80.984 1504 226 38 743 2236 456243400 456244853 0.000000e+00 1138.0
23 TraesCS6B01G106300 chr1A 85.965 57 8 0 662 718 18300676 18300732 9.870000e-06 62.1
24 TraesCS6B01G106300 chr1D 80.870 1495 213 51 759 2237 355668410 355669847 0.000000e+00 1109.0
25 TraesCS6B01G106300 chr1D 87.302 63 8 0 659 721 468248617 468248555 4.560000e-09 73.1
26 TraesCS6B01G106300 chr1B 80.519 1504 227 45 746 2237 478560671 478562120 0.000000e+00 1094.0
27 TraesCS6B01G106300 chr5B 79.879 1486 223 48 762 2237 610107913 610106494 0.000000e+00 1018.0
28 TraesCS6B01G106300 chr5B 79.596 1485 229 52 762 2237 610282401 610280982 0.000000e+00 996.0
29 TraesCS6B01G106300 chr5B 78.396 1509 218 69 743 2226 684085183 684086608 0.000000e+00 881.0
30 TraesCS6B01G106300 chr5B 78.304 507 50 30 2813 3289 469545915 469546391 4.190000e-69 272.0
31 TraesCS6B01G106300 chr5B 89.286 56 6 0 539 594 656138345 656138400 1.640000e-08 71.3
32 TraesCS6B01G106300 chr7D 79.866 1495 203 61 756 2235 19399650 19401061 0.000000e+00 1003.0
33 TraesCS6B01G106300 chr5A 79.704 1488 222 52 762 2237 617097302 617095883 0.000000e+00 1002.0
34 TraesCS6B01G106300 chr5A 79.231 1483 228 51 762 2232 617123656 617122242 0.000000e+00 959.0
35 TraesCS6B01G106300 chr2B 79.192 1485 238 39 759 2236 682258560 682259980 0.000000e+00 965.0
36 TraesCS6B01G106300 chr5D 91.603 655 37 11 2651 3293 412234811 412235459 0.000000e+00 889.0
37 TraesCS6B01G106300 chr5D 94.643 56 3 0 2520 2575 412220238 412220293 1.630000e-13 87.9
38 TraesCS6B01G106300 chrUn 90.107 657 45 10 2649 3293 32057043 32057691 0.000000e+00 835.0
39 TraesCS6B01G106300 chrUn 91.892 148 6 2 2518 2664 32056883 32057025 5.570000e-48 202.0
40 TraesCS6B01G106300 chr7B 79.067 965 165 26 1294 2229 84324790 84325746 2.160000e-176 628.0
41 TraesCS6B01G106300 chr7B 95.238 42 1 1 677 718 386102173 386102213 7.630000e-07 65.8
42 TraesCS6B01G106300 chr3B 82.681 664 59 26 2675 3289 620665255 620665911 3.740000e-149 538.0
43 TraesCS6B01G106300 chr3A 81.982 666 63 17 2675 3289 609828175 609828834 2.270000e-141 512.0
44 TraesCS6B01G106300 chr3D 81.709 667 63 18 2675 3289 466754499 466755158 4.910000e-138 501.0
45 TraesCS6B01G106300 chr3D 80.052 772 67 39 1 716 600114209 600113469 2.950000e-135 492.0
46 TraesCS6B01G106300 chr3D 100.000 29 0 0 686 714 609824188 609824160 2.000000e-03 54.7
47 TraesCS6B01G106300 chr7A 97.297 37 1 0 685 721 47687438 47687402 2.740000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G106300 chr6B 86646466 86649758 3292 False 6082.0 6082 100.0000 1 3293 1 chr6B.!!$F1 3292
1 TraesCS6B01G106300 chr6B 86445244 86447048 1804 True 2950.0 2950 96.1770 719 2522 1 chr6B.!!$R2 1803
2 TraesCS6B01G106300 chr6B 86671227 86673038 1811 True 2896.0 2896 95.5850 719 2522 1 chr6B.!!$R4 1803
3 TraesCS6B01G106300 chr6B 86566245 86567015 770 True 1358.0 1358 98.4440 2523 3293 1 chr6B.!!$R3 770
4 TraesCS6B01G106300 chr6B 87330015 87331473 1458 True 969.0 1328 91.8765 720 2251 2 chr6B.!!$R6 1531
5 TraesCS6B01G106300 chr6B 42484903 42485654 751 True 488.0 488 79.8170 19 718 1 chr6B.!!$R1 699
6 TraesCS6B01G106300 chr6B 617201215 617201927 712 True 466.0 466 79.5150 19 722 1 chr6B.!!$R5 703
7 TraesCS6B01G106300 chr6B 712295784 712296488 704 True 435.5 479 90.7570 1 719 2 chr6B.!!$R7 718
8 TraesCS6B01G106300 chr6D 37116099 37117878 1779 True 2662.0 2662 93.6000 720 2511 1 chr6D.!!$R1 1791
9 TraesCS6B01G106300 chr6D 37225553 37229037 3484 True 1133.5 1345 91.3525 720 2385 2 chr6D.!!$R3 1665
10 TraesCS6B01G106300 chr6D 82563713 82568241 4528 False 537.5 880 92.3650 2521 3293 2 chr6D.!!$F1 772
11 TraesCS6B01G106300 chr6A 48640312 48641838 1526 True 2313.0 2313 93.9870 720 2248 1 chr6A.!!$R1 1528
12 TraesCS6B01G106300 chr4A 69983738 69984508 770 False 1336.0 1336 97.9250 2523 3293 1 chr4A.!!$F1 770
13 TraesCS6B01G106300 chr4A 713604564 713605992 1428 True 1009.0 1009 79.7590 762 2237 1 chr4A.!!$R1 1475
14 TraesCS6B01G106300 chr4B 576111346 576112070 724 True 1245.0 1245 97.7930 1 719 1 chr4B.!!$R2 718
15 TraesCS6B01G106300 chr4B 389691846 389692584 738 True 830.0 830 87.6820 1 718 1 chr4B.!!$R1 717
16 TraesCS6B01G106300 chr1A 456243400 456244853 1453 False 1138.0 1138 80.9840 743 2236 1 chr1A.!!$F2 1493
17 TraesCS6B01G106300 chr1D 355668410 355669847 1437 False 1109.0 1109 80.8700 759 2237 1 chr1D.!!$F1 1478
18 TraesCS6B01G106300 chr1B 478560671 478562120 1449 False 1094.0 1094 80.5190 746 2237 1 chr1B.!!$F1 1491
19 TraesCS6B01G106300 chr5B 610106494 610107913 1419 True 1018.0 1018 79.8790 762 2237 1 chr5B.!!$R1 1475
20 TraesCS6B01G106300 chr5B 610280982 610282401 1419 True 996.0 996 79.5960 762 2237 1 chr5B.!!$R2 1475
21 TraesCS6B01G106300 chr5B 684085183 684086608 1425 False 881.0 881 78.3960 743 2226 1 chr5B.!!$F3 1483
22 TraesCS6B01G106300 chr7D 19399650 19401061 1411 False 1003.0 1003 79.8660 756 2235 1 chr7D.!!$F1 1479
23 TraesCS6B01G106300 chr5A 617095883 617097302 1419 True 1002.0 1002 79.7040 762 2237 1 chr5A.!!$R1 1475
24 TraesCS6B01G106300 chr5A 617122242 617123656 1414 True 959.0 959 79.2310 762 2232 1 chr5A.!!$R2 1470
25 TraesCS6B01G106300 chr2B 682258560 682259980 1420 False 965.0 965 79.1920 759 2236 1 chr2B.!!$F1 1477
26 TraesCS6B01G106300 chr5D 412234811 412235459 648 False 889.0 889 91.6030 2651 3293 1 chr5D.!!$F2 642
27 TraesCS6B01G106300 chrUn 32056883 32057691 808 False 518.5 835 90.9995 2518 3293 2 chrUn.!!$F1 775
28 TraesCS6B01G106300 chr7B 84324790 84325746 956 False 628.0 628 79.0670 1294 2229 1 chr7B.!!$F1 935
29 TraesCS6B01G106300 chr3B 620665255 620665911 656 False 538.0 538 82.6810 2675 3289 1 chr3B.!!$F1 614
30 TraesCS6B01G106300 chr3A 609828175 609828834 659 False 512.0 512 81.9820 2675 3289 1 chr3A.!!$F1 614
31 TraesCS6B01G106300 chr3D 466754499 466755158 659 False 501.0 501 81.7090 2675 3289 1 chr3D.!!$F1 614
32 TraesCS6B01G106300 chr3D 600113469 600114209 740 True 492.0 492 80.0520 1 716 1 chr3D.!!$R1 715

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
702 775 1.552578 GCCCCGGGTAACTTCAAATT 58.447 50.0 21.85 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2404 4449 0.032267 TACAACATGCCACGACGTCA 59.968 50.0 17.16 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 121 2.811431 CCCATTTCACTTCTGTACGCAA 59.189 45.455 0.00 0.00 0.00 4.85
663 736 5.707242 TCGTCTATCGAGGCTTTGATATT 57.293 39.130 6.26 0.00 44.01 1.28
685 758 3.073144 TGTTGCTTGTAAAAGTTCGCC 57.927 42.857 0.00 0.00 0.00 5.54
697 770 1.742880 GTTCGCCCCGGGTAACTTC 60.743 63.158 21.85 1.14 0.00 3.01
702 775 1.552578 GCCCCGGGTAACTTCAAATT 58.447 50.000 21.85 0.00 0.00 1.82
712 785 4.201920 GGTAACTTCAAATTCTGGATCCGC 60.202 45.833 7.39 0.00 0.00 5.54
1158 1248 3.376935 CTTCAGCTGGTCCGCGGAT 62.377 63.158 33.58 12.60 34.24 4.18
1410 3352 0.107643 TCCACAAGGACAACGATGCA 59.892 50.000 0.00 0.00 39.61 3.96
1418 3360 3.853330 CAACGATGCAGCGGACCG 61.853 66.667 29.52 10.29 35.12 4.79
1751 3743 4.790962 CAGCTCCGGCACAGGCAT 62.791 66.667 0.00 0.00 43.71 4.40
2277 4320 0.804933 GCTTTGGTACGCCTACCGAG 60.805 60.000 7.31 8.47 45.22 4.63
2291 4334 2.616634 ACCGAGCGACTAGTCTCATA 57.383 50.000 20.34 0.00 0.00 2.15
2512 4557 4.833126 AGCAATTCAATATCGTTGTACGC 58.167 39.130 0.00 0.00 42.21 4.42
2977 8839 3.254014 GAATGCCGCGCACAACAGT 62.254 57.895 8.75 0.00 43.04 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 121 1.463674 GCATCGGGAACATCAAAGGT 58.536 50.000 0.00 0.00 0.00 3.50
546 594 8.191446 TCTCAAGGACTAGACGAAAAATCTATG 58.809 37.037 0.00 0.00 0.00 2.23
661 734 5.006261 GGCGAACTTTTACAAGCAACAAAAT 59.994 36.000 0.00 0.00 32.57 1.82
663 736 3.860536 GGCGAACTTTTACAAGCAACAAA 59.139 39.130 0.00 0.00 32.57 2.83
685 758 2.752903 CCAGAATTTGAAGTTACCCGGG 59.247 50.000 22.25 22.25 0.00 5.73
712 785 1.224592 GGTAGCCATGGACCAGTGG 59.775 63.158 18.40 7.91 38.55 4.00
1418 3360 4.214327 CCTCGCCGAAGCTCCTCC 62.214 72.222 0.00 0.00 36.60 4.30
1751 3743 1.087501 CATCCACTCTGACTCGTCGA 58.912 55.000 0.00 0.00 0.00 4.20
1924 3943 2.125147 CCACGTGTCCATCGCCAT 60.125 61.111 15.65 0.00 0.00 4.40
2277 4320 8.804688 ATTAATTCTGTTATGAGACTAGTCGC 57.195 34.615 18.64 18.64 34.09 5.19
2337 4382 0.911045 TTCAGGCTGCCTCTGGATCA 60.911 55.000 20.49 0.00 33.36 2.92
2404 4449 0.032267 TACAACATGCCACGACGTCA 59.968 50.000 17.16 0.00 0.00 4.35
2446 4491 0.882042 AGTCAGCAACACTTCTGGCG 60.882 55.000 0.00 0.00 39.71 5.69
2489 4534 4.898488 GCGTACAACGATATTGAATTGCTC 59.102 41.667 3.22 0.00 46.05 4.26
2490 4535 4.570772 AGCGTACAACGATATTGAATTGCT 59.429 37.500 3.22 0.00 46.05 3.91
2977 8839 1.803289 CTCGCGACTGACATCTCCA 59.197 57.895 3.71 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.