Multiple sequence alignment - TraesCS6B01G101100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G101100 chr6B 100.000 3032 0 0 1 3032 79439303 79436272 0.000000e+00 5600.0
1 TraesCS6B01G101100 chr6B 99.407 3035 15 3 1 3032 79556797 79553763 0.000000e+00 5502.0
2 TraesCS6B01G101100 chr6B 96.152 2183 69 9 857 3032 79642267 79640093 0.000000e+00 3552.0
3 TraesCS6B01G101100 chr6B 94.521 2190 96 16 857 3032 78590925 78593104 0.000000e+00 3358.0
4 TraesCS6B01G101100 chr6B 84.950 1495 182 26 991 2477 60107934 60106475 0.000000e+00 1474.0
5 TraesCS6B01G101100 chr6B 93.151 73 5 0 225 297 465695988 465696060 1.150000e-19 108.0
6 TraesCS6B01G101100 chr6B 91.525 59 4 1 125 182 46352580 46352638 2.510000e-11 80.5
7 TraesCS6B01G101100 chr6A 93.189 2085 109 14 956 3032 46296472 46294413 0.000000e+00 3033.0
8 TraesCS6B01G101100 chr6A 94.315 1249 63 4 1039 2279 45667533 45668781 0.000000e+00 1906.0
9 TraesCS6B01G101100 chr6A 86.371 1218 137 18 863 2065 33224565 33223362 0.000000e+00 1303.0
10 TraesCS6B01G101100 chr6A 92.197 628 34 9 2335 2953 45668782 45669403 0.000000e+00 874.0
11 TraesCS6B01G101100 chr6A 91.667 84 4 1 2949 3032 45669562 45669642 2.470000e-21 113.0
12 TraesCS6B01G101100 chr6A 93.243 74 4 1 857 930 45667464 45667536 1.150000e-19 108.0
13 TraesCS6B01G101100 chr6A 86.667 75 8 2 2404 2477 47541595 47541522 6.970000e-12 82.4
14 TraesCS6B01G101100 chrUn 94.348 1433 72 7 856 2280 112304627 112303196 0.000000e+00 2189.0
15 TraesCS6B01G101100 chrUn 94.795 1364 58 6 861 2223 27743446 27744797 0.000000e+00 2113.0
16 TraesCS6B01G101100 chrUn 93.052 734 29 13 2310 3032 112303199 112302477 0.000000e+00 1053.0
17 TraesCS6B01G101100 chrUn 96.021 377 15 0 2143 2519 27744797 27745173 5.560000e-172 614.0
18 TraesCS6B01G101100 chrUn 94.672 244 5 5 2561 2796 27745171 27745414 3.690000e-99 372.0
19 TraesCS6B01G101100 chrUn 76.267 750 129 39 958 1685 112593778 112594500 1.340000e-93 353.0
20 TraesCS6B01G101100 chrUn 95.541 157 4 1 2876 3032 27745415 27745568 6.490000e-62 248.0
21 TraesCS6B01G101100 chrUn 94.366 71 4 0 227 297 5552986 5553056 3.200000e-20 110.0
22 TraesCS6B01G101100 chr6D 84.587 1635 195 35 863 2477 29194649 29196246 0.000000e+00 1570.0
23 TraesCS6B01G101100 chr6D 91.160 181 9 5 298 475 257923649 257923825 3.910000e-59 239.0
24 TraesCS6B01G101100 chr6D 91.473 129 9 2 56 182 257904564 257904436 3.110000e-40 176.0
25 TraesCS6B01G101100 chr6D 93.333 105 7 0 466 570 376939018 376939122 4.050000e-34 156.0
26 TraesCS6B01G101100 chr3A 95.238 189 8 1 673 860 84273430 84273242 6.350000e-77 298.0
27 TraesCS6B01G101100 chr3A 89.051 137 12 2 57 190 498244789 498244925 1.870000e-37 167.0
28 TraesCS6B01G101100 chr4D 94.211 190 10 1 673 861 503922209 503922020 3.820000e-74 289.0
29 TraesCS6B01G101100 chr4D 92.529 174 7 3 299 470 75782219 75782050 8.400000e-61 244.0
30 TraesCS6B01G101100 chr4D 91.367 139 10 2 51 187 328842268 328842130 3.990000e-44 189.0
31 TraesCS6B01G101100 chr4D 87.671 146 13 5 42 182 403164397 403164542 6.720000e-37 165.0
32 TraesCS6B01G101100 chr5D 94.180 189 10 1 673 860 121102476 121102664 1.380000e-73 287.0
33 TraesCS6B01G101100 chr5D 93.750 192 10 2 673 863 130661511 130661321 1.380000e-73 287.0
34 TraesCS6B01G101100 chr5D 87.019 208 19 6 262 467 181626313 181626112 8.460000e-56 228.0
35 TraesCS6B01G101100 chr5D 90.345 145 11 3 49 192 488459926 488460068 1.440000e-43 187.0
36 TraesCS6B01G101100 chr5D 92.453 106 7 1 466 570 510208515 510208620 1.880000e-32 150.0
37 TraesCS6B01G101100 chr5B 94.180 189 10 1 672 859 447830661 447830849 1.380000e-73 287.0
38 TraesCS6B01G101100 chr5B 93.023 172 6 3 298 467 275370134 275369967 2.330000e-61 246.0
39 TraesCS6B01G101100 chr5B 93.204 103 7 0 468 570 344329043 344328941 5.240000e-33 152.0
40 TraesCS6B01G101100 chr5B 96.970 33 0 1 186 218 75901992 75902023 2.000000e-03 54.7
41 TraesCS6B01G101100 chr7D 92.821 195 12 2 673 866 531982559 531982366 6.400000e-72 281.0
42 TraesCS6B01G101100 chr7D 92.821 195 12 2 670 863 555214008 555213815 6.400000e-72 281.0
43 TraesCS6B01G101100 chr7D 92.386 197 14 1 668 863 161844580 161844384 2.300000e-71 279.0
44 TraesCS6B01G101100 chr7D 90.972 144 9 4 51 191 59728125 59727983 1.110000e-44 191.0
45 TraesCS6B01G101100 chr7D 94.366 71 4 0 227 297 31996922 31996852 3.200000e-20 110.0
46 TraesCS6B01G101100 chr1D 92.529 174 7 3 298 469 238940383 238940214 8.400000e-61 244.0
47 TraesCS6B01G101100 chr1D 91.477 176 12 2 294 468 430906121 430905948 3.910000e-59 239.0
48 TraesCS6B01G101100 chr1D 94.366 71 4 0 227 297 379683726 379683656 3.200000e-20 110.0
49 TraesCS6B01G101100 chr2D 91.573 178 9 3 301 476 196347328 196347501 1.090000e-59 241.0
50 TraesCS6B01G101100 chr2D 92.086 139 9 2 51 187 407381855 407381993 8.580000e-46 195.0
51 TraesCS6B01G101100 chr2D 93.269 104 7 0 467 570 481596881 481596778 1.460000e-33 154.0
52 TraesCS6B01G101100 chr2D 94.444 72 4 0 226 297 30327163 30327092 8.890000e-21 111.0
53 TraesCS6B01G101100 chr2D 91.429 70 5 1 124 192 317855579 317855510 8.950000e-16 95.3
54 TraesCS6B01G101100 chr2B 91.573 178 9 3 295 470 174794816 174794989 1.090000e-59 241.0
55 TraesCS6B01G101100 chr2B 94.118 34 2 0 186 219 131872244 131872211 5.000000e-03 52.8
56 TraesCS6B01G101100 chr2B 100.000 28 0 0 186 213 197575763 197575736 5.000000e-03 52.8
57 TraesCS6B01G101100 chr7A 90.441 136 12 1 56 190 687156852 687156717 8.640000e-41 178.0
58 TraesCS6B01G101100 chr3D 88.112 143 15 2 42 182 268126712 268126570 5.200000e-38 169.0
59 TraesCS6B01G101100 chr3D 86.517 89 12 0 209 297 475555018 475555106 6.920000e-17 99.0
60 TraesCS6B01G101100 chr4A 93.269 104 6 1 468 570 619148343 619148446 5.240000e-33 152.0
61 TraesCS6B01G101100 chr4A 91.743 109 8 1 466 574 726577685 726577578 1.880000e-32 150.0
62 TraesCS6B01G101100 chr4A 89.583 96 8 2 98 192 530252333 530252239 1.480000e-23 121.0
63 TraesCS6B01G101100 chr3B 92.233 103 8 0 468 570 823446078 823446180 2.440000e-31 147.0
64 TraesCS6B01G101100 chr3B 100.000 28 0 0 186 213 478048885 478048912 5.000000e-03 52.8
65 TraesCS6B01G101100 chr5A 91.429 105 9 0 466 570 535243584 535243688 8.760000e-31 145.0
66 TraesCS6B01G101100 chr4B 94.286 70 4 0 225 294 500867868 500867937 1.150000e-19 108.0
67 TraesCS6B01G101100 chr4B 100.000 28 0 0 186 213 20679436 20679463 5.000000e-03 52.8
68 TraesCS6B01G101100 chr1B 92.105 76 6 0 227 302 465917097 465917172 1.150000e-19 108.0
69 TraesCS6B01G101100 chr1A 82.759 87 11 4 108 190 462700823 462700737 1.170000e-09 75.0
70 TraesCS6B01G101100 chr1A 100.000 30 0 0 186 215 520851955 520851926 4.220000e-04 56.5
71 TraesCS6B01G101100 chr7B 100.000 32 0 0 186 217 6934199 6934230 3.260000e-05 60.2
72 TraesCS6B01G101100 chr2A 94.118 34 2 0 186 219 3282581 3282548 5.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G101100 chr6B 79436272 79439303 3031 True 5600.00 5600 100.00000 1 3032 1 chr6B.!!$R2 3031
1 TraesCS6B01G101100 chr6B 79553763 79556797 3034 True 5502.00 5502 99.40700 1 3032 1 chr6B.!!$R3 3031
2 TraesCS6B01G101100 chr6B 79640093 79642267 2174 True 3552.00 3552 96.15200 857 3032 1 chr6B.!!$R4 2175
3 TraesCS6B01G101100 chr6B 78590925 78593104 2179 False 3358.00 3358 94.52100 857 3032 1 chr6B.!!$F2 2175
4 TraesCS6B01G101100 chr6B 60106475 60107934 1459 True 1474.00 1474 84.95000 991 2477 1 chr6B.!!$R1 1486
5 TraesCS6B01G101100 chr6A 46294413 46296472 2059 True 3033.00 3033 93.18900 956 3032 1 chr6A.!!$R2 2076
6 TraesCS6B01G101100 chr6A 33223362 33224565 1203 True 1303.00 1303 86.37100 863 2065 1 chr6A.!!$R1 1202
7 TraesCS6B01G101100 chr6A 45667464 45669642 2178 False 750.25 1906 92.85550 857 3032 4 chr6A.!!$F1 2175
8 TraesCS6B01G101100 chrUn 112302477 112304627 2150 True 1621.00 2189 93.70000 856 3032 2 chrUn.!!$R1 2176
9 TraesCS6B01G101100 chrUn 27743446 27745568 2122 False 836.75 2113 95.25725 861 3032 4 chrUn.!!$F3 2171
10 TraesCS6B01G101100 chrUn 112593778 112594500 722 False 353.00 353 76.26700 958 1685 1 chrUn.!!$F2 727
11 TraesCS6B01G101100 chr6D 29194649 29196246 1597 False 1570.00 1570 84.58700 863 2477 1 chr6D.!!$F1 1614

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
696 698 1.17029 GGGTGTTTGGTTCAGGGACG 61.17 60.0 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2296 2450 2.087501 TACATACAACGCCACCACAG 57.912 50.0 0.0 0.0 0.0 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
315 317 2.102084 GTGTTATACTCCCTCCGTTCCC 59.898 54.545 0.0 0.0 0.0 3.97
696 698 1.170290 GGGTGTTTGGTTCAGGGACG 61.170 60.000 0.0 0.0 0.0 4.79
2073 2136 4.839589 AGCCTACCCCCTTTCTCATTATA 58.160 43.478 0.0 0.0 0.0 0.98
2893 3065 6.867816 TGCTACATGCCTTTGATTAGTTTTTG 59.132 34.615 0.0 0.0 42.0 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
158 160 7.881232 CCTTCCCTAATAATAAAGCACGGATTA 59.119 37.037 0.00 0.0 0.00 1.75
696 698 9.327628 ACTTTTTCTAGTCTCTGGAACTAAAAC 57.672 33.333 0.00 0.0 30.99 2.43
827 829 4.455877 CGTTTGCTTCAAAAGTCCTAGGAT 59.544 41.667 16.27 0.0 35.03 3.24
844 846 0.038618 CAAACTTAGGGGGCGTTTGC 60.039 55.000 0.00 0.0 40.41 3.68
2073 2136 4.081420 AGCGTAGACACTTCTGAATGGATT 60.081 41.667 0.00 0.0 32.75 3.01
2296 2450 2.087501 TACATACAACGCCACCACAG 57.912 50.000 0.00 0.0 0.00 3.66
2765 2930 2.426431 TCACAGAGGGGAAGGGTAAA 57.574 50.000 0.00 0.0 0.00 2.01
2893 3065 5.070685 GGATTTGATAGACCCATAACCACC 58.929 45.833 0.00 0.0 0.00 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.