Multiple sequence alignment - TraesCS6B01G098900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G098900 chr6B 100.000 3623 0 0 1 3623 76422658 76419036 0.000000e+00 6691.0
1 TraesCS6B01G098900 chr6B 92.561 1304 80 9 1770 3067 95555295 95556587 0.000000e+00 1855.0
2 TraesCS6B01G098900 chr6B 88.160 1554 103 27 147 1677 95511924 95513419 0.000000e+00 1775.0
3 TraesCS6B01G098900 chr6B 87.130 1554 114 30 147 1677 95553794 95555284 0.000000e+00 1683.0
4 TraesCS6B01G098900 chr6B 99.648 852 3 0 2772 3623 76430825 76429974 0.000000e+00 1557.0
5 TraesCS6B01G098900 chr6B 87.586 145 12 4 22 164 583051366 583051226 2.890000e-36 163.0
6 TraesCS6B01G098900 chrUn 99.091 3631 24 2 1 3622 76991999 76988369 0.000000e+00 6514.0
7 TraesCS6B01G098900 chrUn 98.719 2107 19 1 1 2099 77011633 77009527 0.000000e+00 3735.0
8 TraesCS6B01G098900 chrUn 99.023 1535 15 0 2089 3623 77000853 76999319 0.000000e+00 2752.0
9 TraesCS6B01G098900 chrUn 99.400 1501 9 0 1472 2972 394210379 394208879 0.000000e+00 2723.0
10 TraesCS6B01G098900 chrUn 99.579 1424 6 0 1571 2994 401285584 401287007 0.000000e+00 2597.0
11 TraesCS6B01G098900 chrUn 98.726 628 8 0 2996 3623 406503855 406504482 0.000000e+00 1116.0
12 TraesCS6B01G098900 chrUn 99.485 582 3 0 1 582 468366225 468366806 0.000000e+00 1059.0
13 TraesCS6B01G098900 chrUn 100.000 367 0 0 1 367 453261949 453261583 0.000000e+00 678.0
14 TraesCS6B01G098900 chrUn 84.615 78 10 2 3064 3140 93049736 93049812 3.880000e-10 76.8
15 TraesCS6B01G098900 chr7B 94.522 1570 64 5 149 1706 560501583 560503142 0.000000e+00 2403.0
16 TraesCS6B01G098900 chr7B 91.071 1512 111 9 149 1650 559632837 559634334 0.000000e+00 2023.0
17 TraesCS6B01G098900 chr7B 94.558 147 8 0 1 147 560501012 560501158 1.010000e-55 228.0
18 TraesCS6B01G098900 chr7D 91.753 1552 86 16 167 1706 562197112 562198633 0.000000e+00 2119.0
19 TraesCS6B01G098900 chr7D 90.880 1579 97 20 144 1706 524304253 524305800 0.000000e+00 2074.0
20 TraesCS6B01G098900 chr7D 90.921 1575 98 17 147 1706 524311910 524313454 0.000000e+00 2074.0
21 TraesCS6B01G098900 chr7D 90.758 1569 114 11 147 1703 523547442 523548991 0.000000e+00 2065.0
22 TraesCS6B01G098900 chr7D 93.016 1303 78 5 1770 3067 562198632 562199926 0.000000e+00 1890.0
23 TraesCS6B01G098900 chr7D 92.780 1302 82 5 1770 3067 524251070 524252363 0.000000e+00 1873.0
24 TraesCS6B01G098900 chr7D 92.717 1277 80 5 1770 3041 524313453 524314721 0.000000e+00 1831.0
25 TraesCS6B01G098900 chr7D 92.445 1284 82 7 1770 3048 524305799 524307072 0.000000e+00 1820.0
26 TraesCS6B01G098900 chr7D 93.608 485 27 3 3141 3623 538697794 538698276 0.000000e+00 721.0
27 TraesCS6B01G098900 chr7D 90.698 172 15 1 147 317 524311812 524311983 1.010000e-55 228.0
28 TraesCS6B01G098900 chr6A 90.984 1575 100 14 147 1706 74148751 74150298 0.000000e+00 2084.0
29 TraesCS6B01G098900 chr6A 90.083 1563 109 20 150 1703 52289766 52288241 0.000000e+00 1986.0
30 TraesCS6B01G098900 chr6A 89.535 172 13 3 147 317 74148657 74148824 2.830000e-51 213.0
31 TraesCS6B01G098900 chr6D 92.863 1303 78 8 1770 3067 41622514 41621222 0.000000e+00 1877.0
32 TraesCS6B01G098900 chr6D 95.082 61 2 1 1704 1763 418523596 418523536 1.070000e-15 95.3
33 TraesCS6B01G098900 chr5D 93.608 485 28 3 3141 3623 199841714 199841231 0.000000e+00 721.0
34 TraesCS6B01G098900 chr5D 93.416 486 29 2 3140 3623 435317460 435317944 0.000000e+00 717.0
35 TraesCS6B01G098900 chr5D 84.663 163 17 5 5 164 230416810 230416967 4.840000e-34 156.0
36 TraesCS6B01G098900 chr5A 93.608 485 27 3 3141 3622 399347242 399347725 0.000000e+00 721.0
37 TraesCS6B01G098900 chr3D 92.886 492 31 3 3134 3623 346199999 346200488 0.000000e+00 712.0
38 TraesCS6B01G098900 chr3D 87.586 145 12 3 22 164 537154867 537154727 2.890000e-36 163.0
39 TraesCS6B01G098900 chr3D 85.526 76 7 4 3067 3140 575143225 575143152 3.880000e-10 76.8
40 TraesCS6B01G098900 chr3D 83.951 81 10 3 3062 3140 571181135 571181214 1.400000e-09 75.0
41 TraesCS6B01G098900 chr2D 87.671 146 11 4 21 164 362930804 362930944 2.890000e-36 163.0
42 TraesCS6B01G098900 chr2D 91.549 71 1 5 1697 1763 9913324 9913393 3.850000e-15 93.5
43 TraesCS6B01G098900 chr2A 90.411 73 7 0 3068 3140 26603424 26603352 2.980000e-16 97.1
44 TraesCS6B01G098900 chr1B 91.549 71 4 2 1695 1763 352885050 352884980 2.980000e-16 97.1
45 TraesCS6B01G098900 chr1B 90.278 72 4 3 1694 1763 328029563 328029493 1.390000e-14 91.6
46 TraesCS6B01G098900 chr1D 95.000 60 2 1 1702 1760 310858601 310858542 3.850000e-15 93.5
47 TraesCS6B01G098900 chr7A 84.615 78 10 2 3066 3142 663967301 663967377 3.880000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G098900 chr6B 76419036 76422658 3622 True 6691.000000 6691 100.000000 1 3623 1 chr6B.!!$R1 3622
1 TraesCS6B01G098900 chr6B 95511924 95513419 1495 False 1775.000000 1775 88.160000 147 1677 1 chr6B.!!$F1 1530
2 TraesCS6B01G098900 chr6B 95553794 95556587 2793 False 1769.000000 1855 89.845500 147 3067 2 chr6B.!!$F2 2920
3 TraesCS6B01G098900 chr6B 76429974 76430825 851 True 1557.000000 1557 99.648000 2772 3623 1 chr6B.!!$R2 851
4 TraesCS6B01G098900 chrUn 76988369 76991999 3630 True 6514.000000 6514 99.091000 1 3622 1 chrUn.!!$R1 3621
5 TraesCS6B01G098900 chrUn 77009527 77011633 2106 True 3735.000000 3735 98.719000 1 2099 1 chrUn.!!$R3 2098
6 TraesCS6B01G098900 chrUn 76999319 77000853 1534 True 2752.000000 2752 99.023000 2089 3623 1 chrUn.!!$R2 1534
7 TraesCS6B01G098900 chrUn 394208879 394210379 1500 True 2723.000000 2723 99.400000 1472 2972 1 chrUn.!!$R4 1500
8 TraesCS6B01G098900 chrUn 401285584 401287007 1423 False 2597.000000 2597 99.579000 1571 2994 1 chrUn.!!$F2 1423
9 TraesCS6B01G098900 chrUn 406503855 406504482 627 False 1116.000000 1116 98.726000 2996 3623 1 chrUn.!!$F3 627
10 TraesCS6B01G098900 chrUn 468366225 468366806 581 False 1059.000000 1059 99.485000 1 582 1 chrUn.!!$F4 581
11 TraesCS6B01G098900 chr7B 559632837 559634334 1497 False 2023.000000 2023 91.071000 149 1650 1 chr7B.!!$F1 1501
12 TraesCS6B01G098900 chr7B 560501012 560503142 2130 False 1315.500000 2403 94.540000 1 1706 2 chr7B.!!$F2 1705
13 TraesCS6B01G098900 chr7D 523547442 523548991 1549 False 2065.000000 2065 90.758000 147 1703 1 chr7D.!!$F1 1556
14 TraesCS6B01G098900 chr7D 562197112 562199926 2814 False 2004.500000 2119 92.384500 167 3067 2 chr7D.!!$F6 2900
15 TraesCS6B01G098900 chr7D 524304253 524307072 2819 False 1947.000000 2074 91.662500 144 3048 2 chr7D.!!$F4 2904
16 TraesCS6B01G098900 chr7D 524251070 524252363 1293 False 1873.000000 1873 92.780000 1770 3067 1 chr7D.!!$F2 1297
17 TraesCS6B01G098900 chr7D 524311812 524314721 2909 False 1377.666667 2074 91.445333 147 3041 3 chr7D.!!$F5 2894
18 TraesCS6B01G098900 chr6A 52288241 52289766 1525 True 1986.000000 1986 90.083000 150 1703 1 chr6A.!!$R1 1553
19 TraesCS6B01G098900 chr6A 74148657 74150298 1641 False 1148.500000 2084 90.259500 147 1706 2 chr6A.!!$F1 1559
20 TraesCS6B01G098900 chr6D 41621222 41622514 1292 True 1877.000000 1877 92.863000 1770 3067 1 chr6D.!!$R1 1297

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
408 951 9.899661 ATATCTAAACATGTTTTAGTGGTAGCA 57.100 29.630 27.66 9.54 34.51 3.49 F
1510 2087 1.446099 GTTCTCATCACGCTCGCCA 60.446 57.895 0.00 0.00 0.00 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1510 2087 3.055719 CGGCTTGCCATCACCGTT 61.056 61.111 12.45 0.0 40.77 4.44 R
3090 3686 1.216990 AGGCCCTTATGAACCAGGAG 58.783 55.000 0.00 0.0 30.81 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
408 951 9.899661 ATATCTAAACATGTTTTAGTGGTAGCA 57.100 29.630 27.66 9.54 34.51 3.49
1510 2087 1.446099 GTTCTCATCACGCTCGCCA 60.446 57.895 0.00 0.00 0.00 5.69
1751 2334 7.460751 AGAACGTTTTTGACACTAGTTAGTC 57.539 36.000 0.46 6.44 33.46 2.59
3090 3686 1.102978 AGTGCGGAATTGGGCATTAC 58.897 50.000 3.59 0.00 41.83 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1510 2087 3.055719 CGGCTTGCCATCACCGTT 61.056 61.111 12.45 0.0 40.77 4.44
2928 3524 4.526970 TGGTGATAAAAAGAGCATCCTCC 58.473 43.478 0.00 0.0 38.96 4.30
3090 3686 1.216990 AGGCCCTTATGAACCAGGAG 58.783 55.000 0.00 0.0 30.81 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.