Multiple sequence alignment - TraesCS6B01G087600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G087600 chr6B 100.000 3470 0 0 1 3470 63259093 63255624 0.000000e+00 6408.0
1 TraesCS6B01G087600 chr6B 99.308 3470 22 2 1 3470 63228087 63224620 0.000000e+00 6274.0
2 TraesCS6B01G087600 chr6B 96.000 175 7 0 2557 2731 213152552 213152378 5.670000e-73 285.0
3 TraesCS6B01G087600 chr6B 96.491 171 6 0 2557 2727 525106243 525106413 2.040000e-72 283.0
4 TraesCS6B01G087600 chr6B 93.264 193 12 1 2547 2738 636490637 636490829 2.040000e-72 283.0
5 TraesCS6B01G087600 chrUn 87.081 1432 148 24 1061 2478 102516078 102517486 0.000000e+00 1585.0
6 TraesCS6B01G087600 chrUn 100.000 390 0 0 1840 2229 479944283 479943894 0.000000e+00 721.0
7 TraesCS6B01G087600 chrUn 83.838 99 8 5 985 1075 102515960 102516058 1.720000e-13 87.9
8 TraesCS6B01G087600 chr5B 96.447 957 33 1 1 956 14710032 14710988 0.000000e+00 1578.0
9 TraesCS6B01G087600 chr5B 92.965 199 12 2 2549 2745 346616157 346616355 4.380000e-74 289.0
10 TraesCS6B01G087600 chr5B 86.813 91 11 1 2734 2824 42938925 42939014 2.200000e-17 100.0
11 TraesCS6B01G087600 chr7D 96.025 956 37 1 1 955 550272093 550271138 0.000000e+00 1554.0
12 TraesCS6B01G087600 chr7D 95.716 957 40 1 1 956 37280460 37279504 0.000000e+00 1539.0
13 TraesCS6B01G087600 chr7D 95.611 957 41 1 1 956 384052348 384053304 0.000000e+00 1533.0
14 TraesCS6B01G087600 chr7D 87.209 86 8 3 2740 2824 510874136 510874053 1.030000e-15 95.3
15 TraesCS6B01G087600 chr5D 95.825 958 37 3 1 956 432506287 432505331 0.000000e+00 1544.0
16 TraesCS6B01G087600 chr5D 95.816 956 39 1 1 955 454209833 454208878 0.000000e+00 1543.0
17 TraesCS6B01G087600 chr2D 95.716 957 37 3 1 956 556181279 556180326 0.000000e+00 1537.0
18 TraesCS6B01G087600 chr2D 93.194 191 10 3 2547 2735 589508605 589508794 9.490000e-71 278.0
19 TraesCS6B01G087600 chr2D 78.706 371 74 5 2861 3229 638867049 638867416 3.460000e-60 243.0
20 TraesCS6B01G087600 chr2D 89.706 136 12 2 3091 3224 53126599 53126734 4.600000e-39 172.0
21 TraesCS6B01G087600 chr2D 79.343 213 39 3 3235 3443 638867461 638867672 1.000000e-30 145.0
22 TraesCS6B01G087600 chr6D 95.616 958 40 2 1 957 413389690 413388734 0.000000e+00 1535.0
23 TraesCS6B01G087600 chr6D 80.387 413 77 4 2821 3229 436246826 436247238 9.350000e-81 311.0
24 TraesCS6B01G087600 chr4A 86.527 1336 173 7 988 2323 528645880 528644552 0.000000e+00 1463.0
25 TraesCS6B01G087600 chr4A 86.003 1336 170 7 988 2323 528605897 528604579 0.000000e+00 1415.0
26 TraesCS6B01G087600 chr4A 87.356 87 9 2 2740 2825 492348163 492348248 7.930000e-17 99.0
27 TraesCS6B01G087600 chr6A 86.927 1178 136 5 1050 2209 34550741 34549564 0.000000e+00 1306.0
28 TraesCS6B01G087600 chr6A 88.973 263 26 3 2213 2475 34548685 34548426 4.320000e-84 322.0
29 TraesCS6B01G087600 chr6A 93.333 75 2 3 1071 1143 34551076 34551003 1.320000e-19 108.0
30 TraesCS6B01G087600 chr4B 86.573 782 99 4 988 1769 97923530 97922755 0.000000e+00 857.0
31 TraesCS6B01G087600 chr4B 86.020 608 70 6 1734 2326 97922744 97922137 3.780000e-179 638.0
32 TraesCS6B01G087600 chr3A 80.630 413 69 10 2824 3229 644903097 644902689 3.360000e-80 309.0
33 TraesCS6B01G087600 chr1A 80.542 406 70 6 2822 3223 443129856 443129456 1.560000e-78 303.0
34 TraesCS6B01G087600 chr1A 79.736 227 43 3 2824 3047 490503901 490503675 9.970000e-36 161.0
35 TraesCS6B01G087600 chr1A 87.356 87 9 2 2740 2825 401680406 401680321 7.930000e-17 99.0
36 TraesCS6B01G087600 chr5A 80.147 408 73 7 2821 3222 82882393 82882798 7.280000e-77 298.0
37 TraesCS6B01G087600 chr5A 87.179 156 17 3 3070 3223 7743796 7743642 1.280000e-39 174.0
38 TraesCS6B01G087600 chr5A 87.356 87 9 2 2740 2825 368097216 368097131 7.930000e-17 99.0
39 TraesCS6B01G087600 chr7B 91.748 206 13 3 2550 2754 632273974 632274176 2.040000e-72 283.0
40 TraesCS6B01G087600 chr7B 92.347 196 14 1 2547 2741 741292085 741291890 9.490000e-71 278.0
41 TraesCS6B01G087600 chr7B 87.037 162 20 1 3069 3229 608238543 608238704 7.650000e-42 182.0
42 TraesCS6B01G087600 chr2B 93.651 189 12 0 2550 2738 763446833 763446645 2.040000e-72 283.0
43 TraesCS6B01G087600 chr2B 89.506 162 16 1 3069 3229 713928466 713928305 1.630000e-48 204.0
44 TraesCS6B01G087600 chr1D 83.491 212 32 1 3262 3470 343352630 343352419 9.830000e-46 195.0
45 TraesCS6B01G087600 chr3B 88.272 162 18 1 3069 3229 32527252 32527091 3.530000e-45 193.0
46 TraesCS6B01G087600 chr3B 88.272 162 18 1 3069 3229 32584357 32584196 3.530000e-45 193.0
47 TraesCS6B01G087600 chr3D 87.755 147 18 0 3324 3470 27304585 27304731 4.600000e-39 172.0
48 TraesCS6B01G087600 chr3D 88.372 86 10 0 2739 2824 592318236 592318151 1.700000e-18 104.0
49 TraesCS6B01G087600 chr3D 86.813 91 12 0 2737 2827 508186036 508185946 6.130000e-18 102.0
50 TraesCS6B01G087600 chr4D 84.713 157 21 3 2850 3003 500392708 500392864 1.670000e-33 154.0
51 TraesCS6B01G087600 chr7A 88.506 87 9 1 2740 2826 573419869 573419954 1.700000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G087600 chr6B 63255624 63259093 3469 True 6408.000000 6408 100.000000 1 3470 1 chr6B.!!$R2 3469
1 TraesCS6B01G087600 chr6B 63224620 63228087 3467 True 6274.000000 6274 99.308000 1 3470 1 chr6B.!!$R1 3469
2 TraesCS6B01G087600 chrUn 102515960 102517486 1526 False 836.450000 1585 85.459500 985 2478 2 chrUn.!!$F1 1493
3 TraesCS6B01G087600 chr5B 14710032 14710988 956 False 1578.000000 1578 96.447000 1 956 1 chr5B.!!$F1 955
4 TraesCS6B01G087600 chr7D 550271138 550272093 955 True 1554.000000 1554 96.025000 1 955 1 chr7D.!!$R3 954
5 TraesCS6B01G087600 chr7D 37279504 37280460 956 True 1539.000000 1539 95.716000 1 956 1 chr7D.!!$R1 955
6 TraesCS6B01G087600 chr7D 384052348 384053304 956 False 1533.000000 1533 95.611000 1 956 1 chr7D.!!$F1 955
7 TraesCS6B01G087600 chr5D 432505331 432506287 956 True 1544.000000 1544 95.825000 1 956 1 chr5D.!!$R1 955
8 TraesCS6B01G087600 chr5D 454208878 454209833 955 True 1543.000000 1543 95.816000 1 955 1 chr5D.!!$R2 954
9 TraesCS6B01G087600 chr2D 556180326 556181279 953 True 1537.000000 1537 95.716000 1 956 1 chr2D.!!$R1 955
10 TraesCS6B01G087600 chr6D 413388734 413389690 956 True 1535.000000 1535 95.616000 1 957 1 chr6D.!!$R1 956
11 TraesCS6B01G087600 chr4A 528644552 528645880 1328 True 1463.000000 1463 86.527000 988 2323 1 chr4A.!!$R2 1335
12 TraesCS6B01G087600 chr4A 528604579 528605897 1318 True 1415.000000 1415 86.003000 988 2323 1 chr4A.!!$R1 1335
13 TraesCS6B01G087600 chr6A 34548426 34551076 2650 True 578.666667 1306 89.744333 1050 2475 3 chr6A.!!$R1 1425
14 TraesCS6B01G087600 chr4B 97922137 97923530 1393 True 747.500000 857 86.296500 988 2326 2 chr4B.!!$R1 1338

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
117 118 1.890552 AGGCAAGAGGAGATCATGGT 58.109 50.000 0.00 0.0 0.00 3.55 F
1024 1036 2.483491 GTCCGAGTCCGACCAGTATATC 59.517 54.545 0.56 0.0 38.22 1.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1330 1384 0.111061 AAGCTTGCAGGTCATGGTCA 59.889 50.00 0.0 0.0 31.30 4.02 R
3013 4023 5.796502 TTGAAGGGATCTTAATGGGTCTT 57.203 39.13 0.0 0.0 32.52 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
117 118 1.890552 AGGCAAGAGGAGATCATGGT 58.109 50.000 0.00 0.00 0.00 3.55
1024 1036 2.483491 GTCCGAGTCCGACCAGTATATC 59.517 54.545 0.56 0.00 38.22 1.63
1330 1384 1.202976 ACCCAAGATCAACTGCAGCTT 60.203 47.619 15.27 5.61 0.00 3.74
1838 1957 6.682113 GCGTGACATACCTTGGAATAGTAGAA 60.682 42.308 0.00 0.00 0.00 2.10
2703 3713 7.054124 GGTGAATGAGACCAAATTATACCTCA 58.946 38.462 0.00 0.00 35.48 3.86
3013 4023 4.735132 CTCCGACTTCGCCGCCAA 62.735 66.667 0.00 0.00 38.18 4.52
3047 4057 1.666700 TCCCTTCAAACAAACGACACG 59.333 47.619 0.00 0.00 0.00 4.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1024 1036 5.550981 CAAGACAAACAAACGATCCGATAG 58.449 41.667 0.00 0.0 0.00 2.08
1330 1384 0.111061 AAGCTTGCAGGTCATGGTCA 59.889 50.000 0.00 0.0 31.30 4.02
1838 1957 6.017934 CGTTCGGTCCATCAAGATGATATTTT 60.018 38.462 11.48 0.0 41.20 1.82
3013 4023 5.796502 TTGAAGGGATCTTAATGGGTCTT 57.203 39.130 0.00 0.0 32.52 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.