Multiple sequence alignment - TraesCS6B01G087400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G087400 chr6B 100.000 3470 0 0 1 3470 63228089 63224620 0.000000e+00 6408.0
1 TraesCS6B01G087400 chr6B 99.309 3472 22 2 1 3470 63259095 63255624 0.000000e+00 6277.0
2 TraesCS6B01G087400 chr6B 95.429 175 8 0 2557 2731 213152552 213152378 2.640000e-71 279.0
3 TraesCS6B01G087400 chr6B 95.906 171 7 0 2557 2727 525106243 525106413 9.490000e-71 278.0
4 TraesCS6B01G087400 chr6B 92.746 193 13 1 2547 2738 636490637 636490829 9.490000e-71 278.0
5 TraesCS6B01G087400 chrUn 86.941 1432 150 24 1061 2478 102516078 102517486 0.000000e+00 1574.0
6 TraesCS6B01G087400 chrUn 100.000 390 0 0 1840 2229 479944283 479943894 0.000000e+00 721.0
7 TraesCS6B01G087400 chrUn 84.848 99 7 5 985 1075 102515960 102516058 3.690000e-15 93.5
8 TraesCS6B01G087400 chr5B 95.933 959 36 3 1 956 14710030 14710988 0.000000e+00 1552.0
9 TraesCS6B01G087400 chr5B 92.462 199 13 2 2549 2745 346616157 346616355 2.040000e-72 283.0
10 TraesCS6B01G087400 chr5B 85.887 248 24 8 2557 2795 643251998 643251753 1.600000e-63 254.0
11 TraesCS6B01G087400 chr5B 87.912 91 10 1 2734 2824 42938925 42939014 4.740000e-19 106.0
12 TraesCS6B01G087400 chr7D 95.511 958 40 3 1 955 550272095 550271138 0.000000e+00 1528.0
13 TraesCS6B01G087400 chr7D 95.203 959 43 3 1 956 37280462 37279504 0.000000e+00 1513.0
14 TraesCS6B01G087400 chr7D 95.099 959 44 3 1 956 384052346 384053304 0.000000e+00 1507.0
15 TraesCS6B01G087400 chr5D 95.303 958 42 3 1 955 454209835 454208878 0.000000e+00 1517.0
16 TraesCS6B01G087400 chr5D 95.104 960 42 5 1 956 432506289 432505331 0.000000e+00 1507.0
17 TraesCS6B01G087400 chr2D 95.203 959 40 5 1 956 556181281 556180326 0.000000e+00 1511.0
18 TraesCS6B01G087400 chr2D 79.032 372 71 7 2861 3229 638867049 638867416 7.440000e-62 248.0
19 TraesCS6B01G087400 chr2D 89.706 136 12 2 3091 3224 53126599 53126734 4.600000e-39 172.0
20 TraesCS6B01G087400 chr2D 79.343 213 39 3 3235 3443 638867461 638867672 1.000000e-30 145.0
21 TraesCS6B01G087400 chr6D 95.104 960 43 4 1 957 413389692 413388734 0.000000e+00 1509.0
22 TraesCS6B01G087400 chr6D 80.145 413 78 4 2821 3229 436246826 436247238 4.350000e-79 305.0
23 TraesCS6B01G087400 chr4A 86.677 1336 171 7 988 2323 528645880 528644552 0.000000e+00 1474.0
24 TraesCS6B01G087400 chr4A 86.153 1336 168 7 988 2323 528605897 528604579 0.000000e+00 1426.0
25 TraesCS6B01G087400 chr6A 86.927 1178 136 5 1050 2209 34550741 34549564 0.000000e+00 1306.0
26 TraesCS6B01G087400 chr6A 88.213 263 28 3 2213 2475 34548685 34548426 9.350000e-81 311.0
27 TraesCS6B01G087400 chr6A 93.333 75 2 3 1071 1143 34551076 34551003 1.320000e-19 108.0
28 TraesCS6B01G087400 chr4B 86.829 782 97 4 988 1769 97923530 97922755 0.000000e+00 869.0
29 TraesCS6B01G087400 chr4B 86.020 608 70 6 1734 2326 97922744 97922137 3.780000e-179 638.0
30 TraesCS6B01G087400 chr3A 80.387 413 70 10 2824 3229 644903097 644902689 1.560000e-78 303.0
31 TraesCS6B01G087400 chr3A 83.168 101 16 1 2728 2828 480969582 480969483 1.330000e-14 91.6
32 TraesCS6B01G087400 chr1A 80.590 407 68 8 2822 3223 443129856 443129456 1.560000e-78 303.0
33 TraesCS6B01G087400 chr1A 79.295 227 44 3 2824 3047 490503901 490503675 4.640000e-34 156.0
34 TraesCS6B01G087400 chr1A 88.506 87 8 2 2740 2825 401680406 401680321 1.700000e-18 104.0
35 TraesCS6B01G087400 chr5A 79.902 408 74 7 2821 3222 82882393 82882798 3.390000e-75 292.0
36 TraesCS6B01G087400 chr5A 87.179 156 17 3 3070 3223 7743796 7743642 1.280000e-39 174.0
37 TraesCS6B01G087400 chr5A 88.506 87 8 2 2740 2825 368097216 368097131 1.700000e-18 104.0
38 TraesCS6B01G087400 chr7B 91.262 206 14 3 2550 2754 632273974 632274176 9.490000e-71 278.0
39 TraesCS6B01G087400 chr7B 91.837 196 15 1 2547 2741 741292085 741291890 4.410000e-69 272.0
40 TraesCS6B01G087400 chr7B 87.037 162 20 1 3069 3229 608238543 608238704 7.650000e-42 182.0
41 TraesCS6B01G087400 chr2B 93.122 189 13 0 2550 2738 763446833 763446645 9.490000e-71 278.0
42 TraesCS6B01G087400 chr2B 89.506 162 16 1 3069 3229 713928466 713928305 1.630000e-48 204.0
43 TraesCS6B01G087400 chr1D 83.491 212 32 1 3262 3470 343352630 343352419 9.830000e-46 195.0
44 TraesCS6B01G087400 chr3B 88.272 162 18 1 3069 3229 32527252 32527091 3.530000e-45 193.0
45 TraesCS6B01G087400 chr3B 88.272 162 18 1 3069 3229 32584357 32584196 3.530000e-45 193.0
46 TraesCS6B01G087400 chr3D 87.755 147 18 0 3324 3470 27304585 27304731 4.600000e-39 172.0
47 TraesCS6B01G087400 chr3D 87.912 91 11 0 2737 2827 508186036 508185946 1.320000e-19 108.0
48 TraesCS6B01G087400 chr3D 87.209 86 11 0 2739 2824 592318236 592318151 7.930000e-17 99.0
49 TraesCS6B01G087400 chr4D 84.713 157 21 3 2850 3003 500392708 500392864 1.670000e-33 154.0
50 TraesCS6B01G087400 chr7A 87.356 87 10 1 2740 2826 573419869 573419954 7.930000e-17 99.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G087400 chr6B 63224620 63228089 3469 True 6408.00 6408 100.0000 1 3470 1 chr6B.!!$R1 3469
1 TraesCS6B01G087400 chr6B 63255624 63259095 3471 True 6277.00 6277 99.3090 1 3470 1 chr6B.!!$R2 3469
2 TraesCS6B01G087400 chrUn 102515960 102517486 1526 False 833.75 1574 85.8945 985 2478 2 chrUn.!!$F1 1493
3 TraesCS6B01G087400 chr5B 14710030 14710988 958 False 1552.00 1552 95.9330 1 956 1 chr5B.!!$F1 955
4 TraesCS6B01G087400 chr7D 550271138 550272095 957 True 1528.00 1528 95.5110 1 955 1 chr7D.!!$R2 954
5 TraesCS6B01G087400 chr7D 37279504 37280462 958 True 1513.00 1513 95.2030 1 956 1 chr7D.!!$R1 955
6 TraesCS6B01G087400 chr7D 384052346 384053304 958 False 1507.00 1507 95.0990 1 956 1 chr7D.!!$F1 955
7 TraesCS6B01G087400 chr5D 454208878 454209835 957 True 1517.00 1517 95.3030 1 955 1 chr5D.!!$R2 954
8 TraesCS6B01G087400 chr5D 432505331 432506289 958 True 1507.00 1507 95.1040 1 956 1 chr5D.!!$R1 955
9 TraesCS6B01G087400 chr2D 556180326 556181281 955 True 1511.00 1511 95.2030 1 956 1 chr2D.!!$R1 955
10 TraesCS6B01G087400 chr6D 413388734 413389692 958 True 1509.00 1509 95.1040 1 957 1 chr6D.!!$R1 956
11 TraesCS6B01G087400 chr4A 528644552 528645880 1328 True 1474.00 1474 86.6770 988 2323 1 chr4A.!!$R2 1335
12 TraesCS6B01G087400 chr4A 528604579 528605897 1318 True 1426.00 1426 86.1530 988 2323 1 chr4A.!!$R1 1335
13 TraesCS6B01G087400 chr6A 34548426 34551076 2650 True 575.00 1306 89.4910 1050 2475 3 chr6A.!!$R1 1425
14 TraesCS6B01G087400 chr4B 97922137 97923530 1393 True 753.50 869 86.4245 988 2326 2 chr4B.!!$R1 1338

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
139 140 0.618458 GGTGTCAATGGTGCCCTAGA 59.382 55.0 0.0 0.0 0.0 2.43 F
552 556 1.258676 GGGAACAGGAGAAGACGACT 58.741 55.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2229 3251 4.082125 ACGGGAAAAGCATTCTCAAAGAT 58.918 39.130 3.44 0.0 0.00 2.40 R
3013 4036 5.373812 TTGAAGGGATCTTAATGGGTCTC 57.626 43.478 0.00 0.0 32.52 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
115 116 1.474143 GGGAAAGGCAAGAGGAGATCG 60.474 57.143 0.00 0.00 0.00 3.69
139 140 0.618458 GGTGTCAATGGTGCCCTAGA 59.382 55.000 0.00 0.00 0.00 2.43
552 556 1.258676 GGGAACAGGAGAAGACGACT 58.741 55.000 0.00 0.00 0.00 4.18
2229 3251 3.820467 GTCACATGACATGGAAACAAGGA 59.180 43.478 19.39 1.82 44.18 3.36
2457 3480 8.109705 AGATACATATGAAGCTACAGTCTGAG 57.890 38.462 10.38 1.03 0.00 3.35
2703 3726 6.202954 GGTGAATGAGACCAAATTATACCTCG 59.797 42.308 0.00 0.00 33.25 4.63
3047 4070 2.018515 TCCCTTCAAACAAACGACACC 58.981 47.619 0.00 0.00 0.00 4.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
115 116 2.953821 CACCATTGACACCGCCAC 59.046 61.111 0.00 0.0 0.00 5.01
139 140 1.333636 CCGAGCTCCCATGTCTTCCT 61.334 60.000 8.47 0.0 0.00 3.36
702 707 8.474025 CCAACTGAGACATTAAGAGTAGAGATT 58.526 37.037 0.00 0.0 0.00 2.40
2229 3251 4.082125 ACGGGAAAAGCATTCTCAAAGAT 58.918 39.130 3.44 0.0 0.00 2.40
3013 4036 5.373812 TTGAAGGGATCTTAATGGGTCTC 57.626 43.478 0.00 0.0 32.52 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.