Multiple sequence alignment - TraesCS6B01G087200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G087200 chr6B 100.000 3419 0 0 1 3419 63169976 63166558 0.000000e+00 6314.0
1 TraesCS6B01G087200 chr6B 98.821 2459 13 1 961 3419 63150725 63148283 0.000000e+00 4366.0
2 TraesCS6B01G087200 chr6B 80.473 1439 266 14 971 2403 565393883 565395312 0.000000e+00 1086.0
3 TraesCS6B01G087200 chr6B 91.170 453 36 3 2971 3419 26074377 26073925 2.260000e-171 612.0
4 TraesCS6B01G087200 chr6B 88.713 505 52 3 1 503 47248639 47249140 2.260000e-171 612.0
5 TraesCS6B01G087200 chr2A 93.888 769 46 1 1 768 399499106 399498338 0.000000e+00 1158.0
6 TraesCS6B01G087200 chr2A 93.620 768 49 0 1 768 397817243 397818010 0.000000e+00 1147.0
7 TraesCS6B01G087200 chr2A 88.821 492 46 6 2934 3419 642660372 642659884 2.270000e-166 595.0
8 TraesCS6B01G087200 chr2A 88.298 94 9 2 2813 2905 16908451 16908359 1.000000e-20 111.0
9 TraesCS6B01G087200 chr2A 85.294 102 5 8 2808 2905 759171351 759171256 2.810000e-16 97.1
10 TraesCS6B01G087200 chr6A 80.320 1438 270 12 971 2403 520441376 520442805 0.000000e+00 1075.0
11 TraesCS6B01G087200 chr6A 92.958 213 13 2 753 964 42845372 42845583 3.310000e-80 309.0
12 TraesCS6B01G087200 chr6A 86.441 59 7 1 2645 2703 525228797 525228740 2.850000e-06 63.9
13 TraesCS6B01G087200 chr6D 80.264 1439 269 14 971 2403 379049087 379050516 0.000000e+00 1070.0
14 TraesCS6B01G087200 chr6D 89.865 444 41 2 1 443 194008540 194008100 4.950000e-158 568.0
15 TraesCS6B01G087200 chr3A 90.111 718 67 4 1 715 67960555 67961271 0.000000e+00 929.0
16 TraesCS6B01G087200 chr3A 95.477 199 8 1 763 960 67961372 67961570 1.980000e-82 316.0
17 TraesCS6B01G087200 chr5B 89.836 610 46 9 2810 3418 656710584 656709990 0.000000e+00 769.0
18 TraesCS6B01G087200 chr5B 76.437 174 22 6 2647 2807 654916932 654916765 3.660000e-10 76.8
19 TraesCS6B01G087200 chr3B 89.689 611 50 7 2810 3419 492650213 492649615 0.000000e+00 767.0
20 TraesCS6B01G087200 chr3B 89.140 442 42 3 1 440 11173194 11173631 2.320000e-151 545.0
21 TraesCS6B01G087200 chr3B 83.478 115 15 3 2810 2923 625715254 625715143 1.680000e-18 104.0
22 TraesCS6B01G087200 chr7D 89.959 488 44 5 2934 3419 141649436 141649920 2.900000e-175 625.0
23 TraesCS6B01G087200 chr7D 85.479 606 48 16 2808 3410 36967133 36967701 2.270000e-166 595.0
24 TraesCS6B01G087200 chr7D 87.776 499 54 3 1 495 106996412 106995917 8.230000e-161 577.0
25 TraesCS6B01G087200 chr7D 89.362 94 6 4 2810 2901 36983613 36983704 7.750000e-22 115.0
26 TraesCS6B01G087200 chr4B 88.935 479 50 3 2942 3419 72741712 72742188 3.800000e-164 588.0
27 TraesCS6B01G087200 chr4B 95.477 199 8 1 763 960 251475450 251475252 1.980000e-82 316.0
28 TraesCS6B01G087200 chr7A 89.427 454 45 3 2968 3419 733389738 733389286 1.380000e-158 569.0
29 TraesCS6B01G087200 chr7A 88.865 458 43 7 1 453 37129744 37129290 1.070000e-154 556.0
30 TraesCS6B01G087200 chr3D 89.116 441 44 2 1 440 598540781 598540344 2.320000e-151 545.0
31 TraesCS6B01G087200 chr3D 91.556 225 16 3 744 967 598540075 598539853 1.190000e-79 307.0
32 TraesCS6B01G087200 chr7B 84.309 427 63 2 2997 3419 675065536 675065962 6.830000e-112 414.0
33 TraesCS6B01G087200 chr7B 95.431 197 8 1 769 965 630590184 630589989 2.560000e-81 313.0
34 TraesCS6B01G087200 chr7B 84.694 98 9 5 2810 2905 675070334 675070427 3.630000e-15 93.5
35 TraesCS6B01G087200 chr2D 93.578 218 12 2 744 960 1516938 1517154 1.180000e-84 324.0
36 TraesCS6B01G087200 chr5A 95.098 204 5 3 763 965 250548278 250548079 1.980000e-82 316.0
37 TraesCS6B01G087200 chr5A 90.226 133 13 0 636 768 250548474 250548342 1.260000e-39 174.0
38 TraesCS6B01G087200 chr4A 91.743 218 16 2 744 960 651593945 651593729 5.540000e-78 302.0
39 TraesCS6B01G087200 chr4A 91.743 218 16 2 744 960 651596591 651596375 5.540000e-78 302.0
40 TraesCS6B01G087200 chr2B 83.333 108 12 5 2810 2915 752386871 752386974 1.010000e-15 95.3
41 TraesCS6B01G087200 chr5D 89.831 59 3 1 2649 2704 557889517 557889575 4.730000e-09 73.1
42 TraesCS6B01G087200 chr4D 89.796 49 5 0 2645 2693 1232591 1232639 2.850000e-06 63.9
43 TraesCS6B01G087200 chr4D 91.111 45 1 3 2649 2692 369902240 369902198 1.330000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G087200 chr6B 63166558 63169976 3418 True 6314.0 6314 100.000 1 3419 1 chr6B.!!$R3 3418
1 TraesCS6B01G087200 chr6B 63148283 63150725 2442 True 4366.0 4366 98.821 961 3419 1 chr6B.!!$R2 2458
2 TraesCS6B01G087200 chr6B 565393883 565395312 1429 False 1086.0 1086 80.473 971 2403 1 chr6B.!!$F2 1432
3 TraesCS6B01G087200 chr6B 47248639 47249140 501 False 612.0 612 88.713 1 503 1 chr6B.!!$F1 502
4 TraesCS6B01G087200 chr2A 399498338 399499106 768 True 1158.0 1158 93.888 1 768 1 chr2A.!!$R2 767
5 TraesCS6B01G087200 chr2A 397817243 397818010 767 False 1147.0 1147 93.620 1 768 1 chr2A.!!$F1 767
6 TraesCS6B01G087200 chr6A 520441376 520442805 1429 False 1075.0 1075 80.320 971 2403 1 chr6A.!!$F2 1432
7 TraesCS6B01G087200 chr6D 379049087 379050516 1429 False 1070.0 1070 80.264 971 2403 1 chr6D.!!$F1 1432
8 TraesCS6B01G087200 chr3A 67960555 67961570 1015 False 622.5 929 92.794 1 960 2 chr3A.!!$F1 959
9 TraesCS6B01G087200 chr5B 656709990 656710584 594 True 769.0 769 89.836 2810 3418 1 chr5B.!!$R2 608
10 TraesCS6B01G087200 chr3B 492649615 492650213 598 True 767.0 767 89.689 2810 3419 1 chr3B.!!$R1 609
11 TraesCS6B01G087200 chr7D 36967133 36967701 568 False 595.0 595 85.479 2808 3410 1 chr7D.!!$F1 602
12 TraesCS6B01G087200 chr3D 598539853 598540781 928 True 426.0 545 90.336 1 967 2 chr3D.!!$R1 966
13 TraesCS6B01G087200 chr4A 651593729 651596591 2862 True 302.0 302 91.743 744 960 2 chr4A.!!$R1 216

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
869 2773 0.035152 ACAATGCTCGATGCCCTTGA 60.035 50.0 17.61 0.00 42.00 3.02 F
1680 3584 2.336945 TGCAGGGTATGAATGCTCTG 57.663 50.0 4.07 4.07 42.93 3.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1680 3584 0.179006 CCCCAATGCTCCCTTCTAGC 60.179 60.0 0.00 0.00 40.5 3.42 R
2921 4826 3.219281 TCTCTCTCTCTCTCTCGATCGA 58.781 50.0 18.32 18.32 0.0 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
499 503 3.423162 GATCAGTCGCGCAGGAGCT 62.423 63.158 8.75 0.00 39.10 4.09
869 2773 0.035152 ACAATGCTCGATGCCCTTGA 60.035 50.000 17.61 0.00 42.00 3.02
1680 3584 2.336945 TGCAGGGTATGAATGCTCTG 57.663 50.000 4.07 4.07 42.93 3.35
2405 4309 2.826337 TCCTGGATGGAGATGGTCG 58.174 57.895 0.00 0.00 40.56 4.79
2653 4557 8.910351 ATAAAGGCTTGACCAGAATAATACTC 57.090 34.615 0.00 0.00 43.14 2.59
2719 4623 6.642683 AACTACATGCAGATGTACGTAAAC 57.357 37.500 0.00 0.00 41.27 2.01
2976 4887 7.875041 CGATCTCATTGTTAGGTGGAGAATAAT 59.125 37.037 0.00 0.00 38.05 1.28
3173 5085 7.387673 TGCTATCCAGTTGGTATAAATCGAATG 59.612 37.037 0.00 0.00 36.34 2.67
3234 5146 8.306761 AGTGGGAATCAACTTTGATATGTTTTC 58.693 33.333 4.89 0.00 46.60 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
477 481 1.299468 CCTGCGCGACTGATCTACC 60.299 63.158 12.10 0.00 0.00 3.18
499 503 1.715862 CGTCTCGCGATTCCTCTGGA 61.716 60.000 10.36 0.00 44.77 3.86
540 544 0.404040 GAATCCATCCGGCCCCAATA 59.596 55.000 0.00 0.00 0.00 1.90
869 2773 1.055849 TATATGACAGCCGTGCCCAT 58.944 50.000 0.00 0.00 0.00 4.00
1680 3584 0.179006 CCCCAATGCTCCCTTCTAGC 60.179 60.000 0.00 0.00 40.50 3.42
2405 4309 4.339814 AGATCACCGACTAATGGAGAGTTC 59.660 45.833 0.00 0.00 29.47 3.01
2653 4557 7.005709 AGGTCGTATATTTAGAAATGGAGGG 57.994 40.000 0.00 0.00 0.00 4.30
2919 4824 4.082733 TCTCTCTCTCTCTCTCGATCGATC 60.083 50.000 19.78 15.68 0.00 3.69
2920 4825 3.826729 TCTCTCTCTCTCTCTCGATCGAT 59.173 47.826 19.78 0.00 0.00 3.59
2921 4826 3.219281 TCTCTCTCTCTCTCTCGATCGA 58.781 50.000 18.32 18.32 0.00 3.59
2922 4827 3.643159 TCTCTCTCTCTCTCTCGATCG 57.357 52.381 9.36 9.36 0.00 3.69
2923 4828 6.375736 TCTCTATCTCTCTCTCTCTCTCGATC 59.624 46.154 0.00 0.00 0.00 3.69
2964 4875 6.749036 TCCCTTCTTCTATTATTCTCCACC 57.251 41.667 0.00 0.00 0.00 4.61
2965 4876 9.315363 TCTATCCCTTCTTCTATTATTCTCCAC 57.685 37.037 0.00 0.00 0.00 4.02
3234 5146 3.763097 TCCTATTTTTCATGCACGCAG 57.237 42.857 0.00 0.00 0.00 5.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.