Multiple sequence alignment - TraesCS6B01G078300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G078300 chr6B 100.000 2339 0 0 1 2339 54748078 54745740 0 4320
1 TraesCS6B01G078300 chr6B 97.307 2339 62 1 1 2339 54791929 54789592 0 3969
2 TraesCS6B01G078300 chr5D 95.756 1343 56 1 22 1363 383585999 383587341 0 2163
3 TraesCS6B01G078300 chr5D 95.380 1342 59 2 22 1362 473452364 473453703 0 2132
4 TraesCS6B01G078300 chr2B 95.607 1343 56 3 22 1363 390803507 390802167 0 2150
5 TraesCS6B01G078300 chr2B 95.249 1347 62 2 22 1367 283204562 283205907 0 2132
6 TraesCS6B01G078300 chr2B 91.820 978 79 1 1362 2339 161249792 161250768 0 1362
7 TraesCS6B01G078300 chr4B 95.284 1357 61 3 22 1375 613148871 613150227 0 2148
8 TraesCS6B01G078300 chr4B 92.748 979 69 2 1362 2339 143152999 143152022 0 1413
9 TraesCS6B01G078300 chr1A 95.526 1341 56 4 24 1362 213935696 213937034 0 2141
10 TraesCS6B01G078300 chr3B 95.235 1343 63 1 22 1363 161678825 161677483 0 2124
11 TraesCS6B01G078300 chr3B 92.025 978 77 1 1362 2339 566880770 566881746 0 1373
12 TraesCS6B01G078300 chr3B 91.411 978 83 1 1362 2339 51261882 51262858 0 1339
13 TraesCS6B01G078300 chr3B 91.011 979 84 4 1362 2339 430862694 430863669 0 1317
14 TraesCS6B01G078300 chr5B 95.100 1347 64 2 22 1367 59780939 59779594 0 2121
15 TraesCS6B01G078300 chr5B 90.918 980 86 2 1362 2339 511564919 511563941 0 1314
16 TraesCS6B01G078300 chr5B 90.909 979 86 3 1362 2339 530320407 530321383 0 1312
17 TraesCS6B01G078300 chr3D 92.033 979 76 2 1362 2339 15442867 15443844 0 1375


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G078300 chr6B 54745740 54748078 2338 True 4320 4320 100.000 1 2339 1 chr6B.!!$R1 2338
1 TraesCS6B01G078300 chr6B 54789592 54791929 2337 True 3969 3969 97.307 1 2339 1 chr6B.!!$R2 2338
2 TraesCS6B01G078300 chr5D 383585999 383587341 1342 False 2163 2163 95.756 22 1363 1 chr5D.!!$F1 1341
3 TraesCS6B01G078300 chr5D 473452364 473453703 1339 False 2132 2132 95.380 22 1362 1 chr5D.!!$F2 1340
4 TraesCS6B01G078300 chr2B 390802167 390803507 1340 True 2150 2150 95.607 22 1363 1 chr2B.!!$R1 1341
5 TraesCS6B01G078300 chr2B 283204562 283205907 1345 False 2132 2132 95.249 22 1367 1 chr2B.!!$F2 1345
6 TraesCS6B01G078300 chr2B 161249792 161250768 976 False 1362 1362 91.820 1362 2339 1 chr2B.!!$F1 977
7 TraesCS6B01G078300 chr4B 613148871 613150227 1356 False 2148 2148 95.284 22 1375 1 chr4B.!!$F1 1353
8 TraesCS6B01G078300 chr4B 143152022 143152999 977 True 1413 1413 92.748 1362 2339 1 chr4B.!!$R1 977
9 TraesCS6B01G078300 chr1A 213935696 213937034 1338 False 2141 2141 95.526 24 1362 1 chr1A.!!$F1 1338
10 TraesCS6B01G078300 chr3B 161677483 161678825 1342 True 2124 2124 95.235 22 1363 1 chr3B.!!$R1 1341
11 TraesCS6B01G078300 chr3B 566880770 566881746 976 False 1373 1373 92.025 1362 2339 1 chr3B.!!$F3 977
12 TraesCS6B01G078300 chr3B 51261882 51262858 976 False 1339 1339 91.411 1362 2339 1 chr3B.!!$F1 977
13 TraesCS6B01G078300 chr3B 430862694 430863669 975 False 1317 1317 91.011 1362 2339 1 chr3B.!!$F2 977
14 TraesCS6B01G078300 chr5B 59779594 59780939 1345 True 2121 2121 95.100 22 1367 1 chr5B.!!$R1 1345
15 TraesCS6B01G078300 chr5B 511563941 511564919 978 True 1314 1314 90.918 1362 2339 1 chr5B.!!$R2 977
16 TraesCS6B01G078300 chr5B 530320407 530321383 976 False 1312 1312 90.909 1362 2339 1 chr5B.!!$F1 977
17 TraesCS6B01G078300 chr3D 15442867 15443844 977 False 1375 1375 92.033 1362 2339 1 chr3D.!!$F1 977

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
958 960 5.485353 AGAGATGACAAAGGTAGGTTCATCA 59.515 40.0 11.38 0.0 36.08 3.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1849 1852 0.586802 GCCAGTTTCCAGTGAACGTC 59.413 55.0 0.0 0.0 32.38 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 6.125589 ACCGTAAAATTGTTACCCCTAAGA 57.874 37.500 0.00 0.00 0.00 2.10
676 678 7.676947 ACTATGTATTATGGGCACTCGTAATT 58.323 34.615 0.49 0.00 32.80 1.40
883 885 6.794374 ACGGGATTTGTTAAACTTAACGTTT 58.206 32.000 5.91 7.76 46.94 3.60
958 960 5.485353 AGAGATGACAAAGGTAGGTTCATCA 59.515 40.000 11.38 0.00 36.08 3.07
1041 1043 0.746659 AATTTGGCCTATCGCTTGCC 59.253 50.000 3.32 0.00 45.56 4.52
1074 1076 9.005777 ACGGGTTGTAATCGCATAATTATTAAT 57.994 29.630 0.00 0.00 0.00 1.40
1136 1138 3.839353 GATCATCGGGGGCAGCAGG 62.839 68.421 0.00 0.00 0.00 4.85
1236 1239 5.972107 ATAAAGTTGCTCATGAACTTGCT 57.028 34.783 11.15 1.37 41.71 3.91
1544 1547 1.065199 TCTTGATGGATGGTGGCAGTC 60.065 52.381 0.00 0.00 0.00 3.51
1795 1798 2.092484 TGCCTATGCTAGTTTCATGGCA 60.092 45.455 14.75 14.75 41.35 4.92
1849 1852 1.185315 CTGGCCCCAAAGGTGTAATG 58.815 55.000 0.00 0.00 38.26 1.90
1871 1876 1.403679 CGTTCACTGGAAACTGGCAAA 59.596 47.619 0.00 0.00 34.13 3.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 2.025887 CCTTCCATAACAACTGGCCTCT 60.026 50.000 3.32 0.00 33.56 3.69
676 678 1.175654 ATGGCAATCATGTCACGCAA 58.824 45.000 0.00 0.00 45.49 4.85
883 885 4.922206 AGGTCATGGTCAAAAGAAGCATA 58.078 39.130 0.00 0.00 33.32 3.14
958 960 3.596046 TCAATCTTACCATTTCCCCCACT 59.404 43.478 0.00 0.00 0.00 4.00
1041 1043 1.735571 CGATTACAACCCGTCCTTTGG 59.264 52.381 0.00 0.00 0.00 3.28
1074 1076 5.090845 TCGATCACCTCCATATTATCCCAA 58.909 41.667 0.00 0.00 0.00 4.12
1136 1138 6.901357 GTGAAAACAGTCATCAAAAATTGCAC 59.099 34.615 0.00 0.00 0.00 4.57
1236 1239 4.735369 TCAAGGAAAATCTGGCCAACTTA 58.265 39.130 7.01 0.00 0.00 2.24
1367 1370 1.620822 GGAGCAACCATGTTCACCTT 58.379 50.000 0.00 0.00 38.43 3.50
1544 1547 5.569441 CCTCAGCGTACAATATATTCAGACG 59.431 44.000 14.57 14.57 0.00 4.18
1795 1798 2.163815 GAGGTACACATAGCACAGTCGT 59.836 50.000 0.00 0.00 0.00 4.34
1849 1852 0.586802 GCCAGTTTCCAGTGAACGTC 59.413 55.000 0.00 0.00 32.38 4.34
2316 2324 3.186817 CACTCGGAGTGGTATATCTCGTC 59.813 52.174 26.72 0.00 42.35 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.