Multiple sequence alignment - TraesCS6B01G065900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G065900 chr6B 100.000 2452 0 0 1 2452 43571160 43573611 0.000000e+00 4529
1 TraesCS6B01G065900 chr6B 99.062 2452 23 0 1 2452 43559961 43562412 0.000000e+00 4401
2 TraesCS6B01G065900 chr6B 97.247 2470 41 4 1 2452 43548740 43551200 0.000000e+00 4159
3 TraesCS6B01G065900 chr6B 97.173 2476 37 6 1 2452 43520249 43522715 0.000000e+00 4154
4 TraesCS6B01G065900 chr6B 98.770 1138 14 0 1315 2452 43533127 43534264 0.000000e+00 2025
5 TraesCS6B01G065900 chr6B 89.588 1335 122 14 1132 2452 62654369 62655700 0.000000e+00 1679
6 TraesCS6B01G065900 chrUn 90.963 2202 145 23 1 2194 94345348 94347503 0.000000e+00 2915
7 TraesCS6B01G065900 chrUn 99.630 1081 4 0 754 1834 442289362 442288282 0.000000e+00 1975
8 TraesCS6B01G065900 chrUn 88.834 1630 113 28 304 1931 180994204 180995766 0.000000e+00 1938
9 TraesCS6B01G065900 chrUn 93.249 1185 65 10 1 1173 94315999 94317180 0.000000e+00 1731
10 TraesCS6B01G065900 chrUn 92.766 1175 60 9 1 1169 94399321 94400476 0.000000e+00 1676
11 TraesCS6B01G065900 chrUn 92.262 1189 70 10 1 1183 325490907 325489735 0.000000e+00 1666
12 TraesCS6B01G065900 chrUn 92.466 1168 66 9 1 1162 325949778 325950929 0.000000e+00 1650
13 TraesCS6B01G065900 chrUn 91.764 1202 63 23 1 1169 284306344 284307542 0.000000e+00 1639
14 TraesCS6B01G065900 chrUn 91.375 1171 64 8 1 1165 94431542 94432681 0.000000e+00 1568
15 TraesCS6B01G065900 chrUn 90.732 1025 87 3 1172 2194 94400437 94401455 0.000000e+00 1360
16 TraesCS6B01G065900 chrUn 90.784 1020 86 3 1177 2194 284307505 284308518 0.000000e+00 1356
17 TraesCS6B01G065900 chrUn 90.714 1023 87 3 1174 2194 325489777 325488761 0.000000e+00 1356
18 TraesCS6B01G065900 chrUn 91.369 869 63 6 304 1166 229104045 229104907 0.000000e+00 1179
19 TraesCS6B01G065900 chrUn 88.763 881 60 14 304 1184 181032899 181033740 0.000000e+00 1042
20 TraesCS6B01G065900 chrUn 92.045 264 21 0 2189 2452 94617602 94617865 2.980000e-99 372


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G065900 chr6B 43571160 43573611 2451 False 4529.0 4529 100.000 1 2452 1 chr6B.!!$F5 2451
1 TraesCS6B01G065900 chr6B 43559961 43562412 2451 False 4401.0 4401 99.062 1 2452 1 chr6B.!!$F4 2451
2 TraesCS6B01G065900 chr6B 43548740 43551200 2460 False 4159.0 4159 97.247 1 2452 1 chr6B.!!$F3 2451
3 TraesCS6B01G065900 chr6B 43520249 43522715 2466 False 4154.0 4154 97.173 1 2452 1 chr6B.!!$F1 2451
4 TraesCS6B01G065900 chr6B 43533127 43534264 1137 False 2025.0 2025 98.770 1315 2452 1 chr6B.!!$F2 1137
5 TraesCS6B01G065900 chr6B 62654369 62655700 1331 False 1679.0 1679 89.588 1132 2452 1 chr6B.!!$F6 1320
6 TraesCS6B01G065900 chrUn 94345348 94347503 2155 False 2915.0 2915 90.963 1 2194 1 chrUn.!!$F2 2193
7 TraesCS6B01G065900 chrUn 442288282 442289362 1080 True 1975.0 1975 99.630 754 1834 1 chrUn.!!$R1 1080
8 TraesCS6B01G065900 chrUn 180994204 180995766 1562 False 1938.0 1938 88.834 304 1931 1 chrUn.!!$F5 1627
9 TraesCS6B01G065900 chrUn 94315999 94317180 1181 False 1731.0 1731 93.249 1 1173 1 chrUn.!!$F1 1172
10 TraesCS6B01G065900 chrUn 325949778 325950929 1151 False 1650.0 1650 92.466 1 1162 1 chrUn.!!$F8 1161
11 TraesCS6B01G065900 chrUn 94431542 94432681 1139 False 1568.0 1568 91.375 1 1165 1 chrUn.!!$F3 1164
12 TraesCS6B01G065900 chrUn 94399321 94401455 2134 False 1518.0 1676 91.749 1 2194 2 chrUn.!!$F9 2193
13 TraesCS6B01G065900 chrUn 325488761 325490907 2146 True 1511.0 1666 91.488 1 2194 2 chrUn.!!$R2 2193
14 TraesCS6B01G065900 chrUn 284306344 284308518 2174 False 1497.5 1639 91.274 1 2194 2 chrUn.!!$F10 2193
15 TraesCS6B01G065900 chrUn 229104045 229104907 862 False 1179.0 1179 91.369 304 1166 1 chrUn.!!$F7 862
16 TraesCS6B01G065900 chrUn 181032899 181033740 841 False 1042.0 1042 88.763 304 1184 1 chrUn.!!$F6 880

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
909 1045 6.03761 ACAACAACAACAACAACAACAACAAT 59.962 30.769 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2025 2274 0.474854 TGGCCACTTCTTACTCCCCA 60.475 55.0 0.0 0.0 0.0 4.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
909 1045 6.037610 ACAACAACAACAACAACAACAACAAT 59.962 30.769 0.00 0.0 0.00 2.71
1273 1514 4.467769 CAATATCCATCAAGCCAGGTCTT 58.532 43.478 0.00 0.0 0.00 3.01
1834 2083 6.267471 CCTTGGCTTGCCCTTTATCAATTATA 59.733 38.462 9.35 0.0 0.00 0.98
2022 2271 1.911766 GAGAGGTGTTCCGGGTGGA 60.912 63.158 0.00 0.0 44.61 4.02
2025 2274 3.246880 GGTGTTCCGGGTGGACCT 61.247 66.667 0.00 0.0 46.45 3.85
2222 2476 0.906775 CCTTACTTGGCCCCTCGTTA 59.093 55.000 0.00 0.0 0.00 3.18
2264 2518 7.846107 CGATAGTTTTGTCTCGGTTCAAATATG 59.154 37.037 0.00 0.0 34.30 1.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
909 1045 7.378966 TGAAGGATTTGTTGTTGTTGTTGTTA 58.621 30.769 0.00 0.0 0.00 2.41
1199 1440 2.223157 CGACGGTTGTTGTCATTGTTGT 60.223 45.455 0.00 0.0 36.11 3.32
1206 1447 1.593209 GGCTCGACGGTTGTTGTCA 60.593 57.895 0.00 0.0 36.11 3.58
1273 1514 2.165357 TAGCTGAGATGGCTGGAAGA 57.835 50.000 0.00 0.0 40.52 2.87
1834 2083 6.127101 TGATGAATTGAATGCTTCTCTGGAT 58.873 36.000 1.35 0.0 0.00 3.41
2001 2250 0.613853 CACCCGGAACACCTCTCCTA 60.614 60.000 0.73 0.0 0.00 2.94
2022 2271 1.657804 CCACTTCTTACTCCCCAGGT 58.342 55.000 0.00 0.0 0.00 4.00
2025 2274 0.474854 TGGCCACTTCTTACTCCCCA 60.475 55.000 0.00 0.0 0.00 4.96
2222 2476 5.917541 ACTATCGTCAAACGTGTTTTCAT 57.082 34.783 0.00 0.0 43.14 2.57
2264 2518 8.617809 TCCTATGAACTTTGTTAAACTTGACAC 58.382 33.333 0.00 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.