Multiple sequence alignment - TraesCS6B01G048400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G048400 chr6B 100.000 2486 0 0 1 2486 28470469 28472954 0.000000e+00 4591
1 TraesCS6B01G048400 chr6B 96.918 1525 47 0 962 2486 59305352 59303828 0.000000e+00 2556
2 TraesCS6B01G048400 chr6B 98.400 750 11 1 1 750 77388861 77388113 0.000000e+00 1317
3 TraesCS6B01G048400 chr6B 85.825 1157 132 26 956 2090 28748039 28746893 0.000000e+00 1199
4 TraesCS6B01G048400 chr6B 85.825 1157 132 26 956 2090 28753405 28752259 0.000000e+00 1199
5 TraesCS6B01G048400 chr6B 78.517 1052 204 13 959 1997 26794084 26793042 0.000000e+00 671
6 TraesCS6B01G048400 chr6B 87.500 224 12 7 751 960 28748298 28748077 6.870000e-61 244
7 TraesCS6B01G048400 chr6B 87.500 224 12 7 751 960 28753664 28753443 6.870000e-61 244
8 TraesCS6B01G048400 chr6A 93.459 1544 73 13 959 2486 16628960 16630491 0.000000e+00 2266
9 TraesCS6B01G048400 chr6A 98.933 750 8 0 1 750 453913428 453914177 0.000000e+00 1341
10 TraesCS6B01G048400 chr6A 80.756 1190 201 23 967 2142 15694585 15695760 0.000000e+00 904
11 TraesCS6B01G048400 chr6A 80.134 1198 201 25 958 2124 15647237 15648428 0.000000e+00 859
12 TraesCS6B01G048400 chr6D 92.866 1542 80 10 962 2486 16368938 16370466 0.000000e+00 2211
13 TraesCS6B01G048400 chr6D 79.170 1205 216 26 972 2151 14727352 14726158 0.000000e+00 802
14 TraesCS6B01G048400 chr5A 99.200 750 6 0 1 750 453348230 453348979 0.000000e+00 1352
15 TraesCS6B01G048400 chr7A 99.067 750 7 0 1 750 97239030 97238281 0.000000e+00 1347
16 TraesCS6B01G048400 chr3B 98.681 758 10 0 1 758 225183196 225183953 0.000000e+00 1345
17 TraesCS6B01G048400 chr3B 98.533 750 11 0 1 750 751911272 751910523 0.000000e+00 1325
18 TraesCS6B01G048400 chr7B 98.411 755 10 2 1 754 561137864 561138617 0.000000e+00 1327
19 TraesCS6B01G048400 chr7B 98.026 760 13 2 1 759 720639718 720640476 0.000000e+00 1319
20 TraesCS6B01G048400 chr2A 97.490 757 17 2 1 757 663301368 663300614 0.000000e+00 1291
21 TraesCS6B01G048400 chrUn 85.825 1157 132 26 956 2090 76387433 76386287 0.000000e+00 1199
22 TraesCS6B01G048400 chrUn 96.962 395 12 0 2092 2486 76385706 76385312 0.000000e+00 664
23 TraesCS6B01G048400 chrUn 87.500 224 12 7 751 960 76387692 76387471 6.870000e-61 244
24 TraesCS6B01G048400 chr1B 86.040 702 83 8 1788 2482 48092874 48092181 0.000000e+00 739
25 TraesCS6B01G048400 chr1B 86.427 361 35 8 962 1311 48142679 48142322 1.390000e-102 383
26 TraesCS6B01G048400 chr7D 80.519 154 30 0 2063 2216 568370254 568370101 4.340000e-23 119


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G048400 chr6B 28470469 28472954 2485 False 4591.000000 4591 100.000000 1 2486 1 chr6B.!!$F1 2485
1 TraesCS6B01G048400 chr6B 59303828 59305352 1524 True 2556.000000 2556 96.918000 962 2486 1 chr6B.!!$R2 1524
2 TraesCS6B01G048400 chr6B 77388113 77388861 748 True 1317.000000 1317 98.400000 1 750 1 chr6B.!!$R3 749
3 TraesCS6B01G048400 chr6B 28746893 28753664 6771 True 721.500000 1199 86.662500 751 2090 4 chr6B.!!$R4 1339
4 TraesCS6B01G048400 chr6B 26793042 26794084 1042 True 671.000000 671 78.517000 959 1997 1 chr6B.!!$R1 1038
5 TraesCS6B01G048400 chr6A 16628960 16630491 1531 False 2266.000000 2266 93.459000 959 2486 1 chr6A.!!$F3 1527
6 TraesCS6B01G048400 chr6A 453913428 453914177 749 False 1341.000000 1341 98.933000 1 750 1 chr6A.!!$F4 749
7 TraesCS6B01G048400 chr6A 15694585 15695760 1175 False 904.000000 904 80.756000 967 2142 1 chr6A.!!$F2 1175
8 TraesCS6B01G048400 chr6A 15647237 15648428 1191 False 859.000000 859 80.134000 958 2124 1 chr6A.!!$F1 1166
9 TraesCS6B01G048400 chr6D 16368938 16370466 1528 False 2211.000000 2211 92.866000 962 2486 1 chr6D.!!$F1 1524
10 TraesCS6B01G048400 chr6D 14726158 14727352 1194 True 802.000000 802 79.170000 972 2151 1 chr6D.!!$R1 1179
11 TraesCS6B01G048400 chr5A 453348230 453348979 749 False 1352.000000 1352 99.200000 1 750 1 chr5A.!!$F1 749
12 TraesCS6B01G048400 chr7A 97238281 97239030 749 True 1347.000000 1347 99.067000 1 750 1 chr7A.!!$R1 749
13 TraesCS6B01G048400 chr3B 225183196 225183953 757 False 1345.000000 1345 98.681000 1 758 1 chr3B.!!$F1 757
14 TraesCS6B01G048400 chr3B 751910523 751911272 749 True 1325.000000 1325 98.533000 1 750 1 chr3B.!!$R1 749
15 TraesCS6B01G048400 chr7B 561137864 561138617 753 False 1327.000000 1327 98.411000 1 754 1 chr7B.!!$F1 753
16 TraesCS6B01G048400 chr7B 720639718 720640476 758 False 1319.000000 1319 98.026000 1 759 1 chr7B.!!$F2 758
17 TraesCS6B01G048400 chr2A 663300614 663301368 754 True 1291.000000 1291 97.490000 1 757 1 chr2A.!!$R1 756
18 TraesCS6B01G048400 chrUn 76385312 76387692 2380 True 702.333333 1199 90.095667 751 2486 3 chrUn.!!$R1 1735
19 TraesCS6B01G048400 chr1B 48092181 48092874 693 True 739.000000 739 86.040000 1788 2482 1 chr1B.!!$R1 694

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
960 976 1.002087 GGACGACAACCCATTCACTCT 59.998 52.381 0.0 0.0 0.0 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1881 1979 1.273327 GCAATGAGGGTTGGTTCCAAG 59.727 52.381 4.37 0.0 0.0 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 4.141981 CCTCAAGATGCACATCTCACTAGT 60.142 45.833 13.31 0.00 46.75 2.57
466 468 4.224147 TCCATGTGGGATCTAGTTTCGAAA 59.776 41.667 6.47 6.47 42.15 3.46
760 762 5.227908 GGTAGACACGTCCCATTGTATATG 58.772 45.833 0.00 0.00 0.00 1.78
764 766 3.138304 CACGTCCCATTGTATATGGTGG 58.862 50.000 3.34 0.00 37.48 4.61
773 775 5.837979 CCATTGTATATGGTGGGAAAATCCA 59.162 40.000 0.00 0.00 34.76 3.41
783 785 5.825151 TGGTGGGAAAATCCAAAAATGAAAC 59.175 36.000 0.00 0.00 38.64 2.78
791 793 9.316859 GAAAATCCAAAAATGAAACTATTTGCG 57.683 29.630 0.00 0.00 32.73 4.85
806 808 7.365840 ACTATTTGCGGAAACAAAACAAAAA 57.634 28.000 3.52 0.00 42.45 1.94
940 956 3.490348 ACTCTGGTCCAATCACCAAAAG 58.510 45.455 0.00 0.00 46.19 2.27
960 976 1.002087 GGACGACAACCCATTCACTCT 59.998 52.381 0.00 0.00 0.00 3.24
1039 1104 0.108756 CGTCTTTTCCCGTCTCCTCC 60.109 60.000 0.00 0.00 0.00 4.30
1367 1465 1.725557 GGCATAGGTCTCTCGCGTCA 61.726 60.000 5.77 0.00 0.00 4.35
1446 1544 1.275291 TCCAAGCTGCAGTACTACCAC 59.725 52.381 16.64 0.00 0.00 4.16
1485 1583 1.294138 CAACTTCCTCCGGGCGTAA 59.706 57.895 0.00 0.00 0.00 3.18
1693 1791 1.450312 CGTGGCTCTGGGATGTTCC 60.450 63.158 0.00 0.00 35.23 3.62
1696 1794 0.982852 TGGCTCTGGGATGTTCCGAT 60.983 55.000 0.00 0.00 37.43 4.18
1881 1979 0.691078 TCCTGGTATCTGAGGTGGGC 60.691 60.000 0.00 0.00 0.00 5.36
1893 1991 2.207229 GGTGGGCTTGGAACCAACC 61.207 63.158 1.83 8.87 38.54 3.77
2075 2173 2.184322 GCGCCCTCACATCGAAGA 59.816 61.111 0.00 0.00 45.75 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 0.116143 CCCCTTTCCATCCAACCCAA 59.884 55.000 0.00 0.00 0.00 4.12
466 468 1.009829 GAAATCCTCGCGATGTGCTT 58.990 50.000 10.36 2.18 43.27 3.91
760 762 6.061441 AGTTTCATTTTTGGATTTTCCCACC 58.939 36.000 0.00 0.00 35.03 4.61
764 766 9.611284 GCAAATAGTTTCATTTTTGGATTTTCC 57.389 29.630 0.00 0.00 36.96 3.13
765 767 9.316859 CGCAAATAGTTTCATTTTTGGATTTTC 57.683 29.630 0.00 0.00 31.37 2.29
773 775 7.778470 TGTTTCCGCAAATAGTTTCATTTTT 57.222 28.000 0.00 0.00 0.00 1.94
806 808 6.734137 TGTGAAGTATGTTTTCTCGCATTTT 58.266 32.000 0.00 0.00 0.00 1.82
897 902 1.002257 ATGGGCTTGCGTGTGATCA 60.002 52.632 0.00 0.00 0.00 2.92
909 925 0.329596 GGACCAGAGTTTGATGGGCT 59.670 55.000 0.00 0.00 44.70 5.19
940 956 1.002087 AGAGTGAATGGGTTGTCGTCC 59.998 52.381 0.00 0.00 0.00 4.79
1039 1104 1.621672 GCAGAGGTGGAGGAAGGAGG 61.622 65.000 0.00 0.00 0.00 4.30
1367 1465 3.983494 CGAGGCGGGCGATCTCAT 61.983 66.667 0.00 0.00 0.00 2.90
1446 1544 2.689034 AAGGAGCCGAAGAGGGGG 60.689 66.667 0.00 0.00 41.48 5.40
1485 1583 1.144913 AGAAGATAGGAGGAGCGCTCT 59.855 52.381 34.46 21.46 0.00 4.09
1881 1979 1.273327 GCAATGAGGGTTGGTTCCAAG 59.727 52.381 4.37 0.00 0.00 3.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.