Multiple sequence alignment - TraesCS6B01G046300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G046300 chr6B 100.000 3073 0 0 1 3073 27533890 27530818 0.000000e+00 5675.0
1 TraesCS6B01G046300 chr6B 99.251 2939 21 1 1 2939 27487300 27484363 0.000000e+00 5304.0
2 TraesCS6B01G046300 chr6B 98.430 2421 35 3 521 2939 27420580 27418161 0.000000e+00 4257.0
3 TraesCS6B01G046300 chr6B 98.223 2420 40 3 521 2939 27456648 27454231 0.000000e+00 4228.0
4 TraesCS6B01G046300 chr6B 99.617 261 1 0 1 261 27420849 27420589 7.710000e-131 477.0
5 TraesCS6B01G046300 chr6B 99.617 261 1 0 1 261 27456917 27456657 7.710000e-131 477.0
6 TraesCS6B01G046300 chr6B 96.970 132 4 0 2942 3073 27418067 27417936 3.990000e-54 222.0
7 TraesCS6B01G046300 chr6B 98.400 125 2 0 1272 1396 27668934 27669058 1.430000e-53 220.0
8 TraesCS6B01G046300 chr6B 96.899 129 4 0 2945 3073 27454134 27454006 1.860000e-52 217.0
9 TraesCS6B01G046300 chr6B 95.556 135 6 0 2939 3073 27484272 27484138 1.860000e-52 217.0
10 TraesCS6B01G046300 chrUn 99.082 1089 10 0 811 1899 441169750 441168662 0.000000e+00 1956.0
11 TraesCS6B01G046300 chrUn 91.362 1123 85 7 1543 2659 319197560 319196444 0.000000e+00 1526.0
12 TraesCS6B01G046300 chrUn 90.355 1099 89 10 1725 2816 348953558 348954646 0.000000e+00 1426.0
13 TraesCS6B01G046300 chrUn 91.318 933 74 6 1725 2656 459176789 459177715 0.000000e+00 1267.0
14 TraesCS6B01G046300 chrUn 91.250 720 60 3 1449 2167 76409200 76409917 0.000000e+00 977.0
15 TraesCS6B01G046300 chrUn 92.180 422 23 7 747 1159 76417691 76417271 3.410000e-164 588.0
16 TraesCS6B01G046300 chrUn 92.180 422 23 7 747 1159 311042688 311042268 3.410000e-164 588.0
17 TraesCS6B01G046300 chrUn 87.413 429 34 3 2388 2816 76413677 76414085 2.770000e-130 475.0
18 TraesCS6B01G046300 chrUn 89.231 390 25 8 1013 1396 319198050 319197672 3.590000e-129 472.0
19 TraesCS6B01G046300 chrUn 89.231 390 25 8 1013 1396 347746851 347746473 3.590000e-129 472.0
20 TraesCS6B01G046300 chrUn 87.838 74 5 1 2743 2816 322192708 322192639 1.960000e-12 84.2
21 TraesCS6B01G046300 chr6D 89.409 1388 108 16 1446 2816 15551264 15549899 0.000000e+00 1712.0
22 TraesCS6B01G046300 chr6D 88.290 1298 109 20 1541 2816 15586383 15585107 0.000000e+00 1515.0
23 TraesCS6B01G046300 chr6D 91.604 929 53 13 487 1396 15552184 15551262 0.000000e+00 1260.0
24 TraesCS6B01G046300 chr6D 89.087 843 58 10 59 878 15600366 15599535 0.000000e+00 1016.0
25 TraesCS6B01G046300 chr6D 86.644 599 51 11 1 580 15552769 15552181 1.200000e-178 636.0
26 TraesCS6B01G046300 chr6D 86.547 446 34 8 951 1396 15639950 15640369 4.640000e-128 468.0
27 TraesCS6B01G046300 chr6D 89.820 334 24 7 872 1195 15589833 15589500 1.320000e-113 420.0
28 TraesCS6B01G046300 chr6D 87.540 313 24 3 596 897 15639622 15639930 6.310000e-92 348.0
29 TraesCS6B01G046300 chr6D 92.208 154 12 0 6 159 15525182 15525029 5.160000e-53 219.0
30 TraesCS6B01G046300 chr6D 93.976 83 5 0 1446 1528 15640367 15640449 3.220000e-25 126.0
31 TraesCS6B01G046300 chr6A 89.785 979 62 15 1 955 16336554 16337518 0.000000e+00 1219.0
32 TraesCS6B01G046300 chr6A 87.273 440 22 16 988 1396 16337587 16338023 3.590000e-129 472.0
33 TraesCS6B01G046300 chr6A 87.662 308 31 4 2512 2816 16287981 16287678 4.880000e-93 351.0
34 TraesCS6B01G046300 chr6A 94.771 153 8 0 6 158 16240139 16239987 3.960000e-59 239.0
35 TraesCS6B01G046300 chr4D 88.148 135 16 0 2939 3073 494005648 494005782 8.820000e-36 161.0
36 TraesCS6B01G046300 chr3B 88.636 132 15 0 2942 3073 680429134 680429003 8.820000e-36 161.0
37 TraesCS6B01G046300 chr3B 88.525 122 10 3 2819 2939 680429346 680429228 8.880000e-31 145.0
38 TraesCS6B01G046300 chr3B 84.091 132 21 0 2942 3073 796064705 796064574 8.940000e-26 128.0
39 TraesCS6B01G046300 chr1B 87.407 135 17 0 2939 3073 115754565 115754699 4.100000e-34 156.0
40 TraesCS6B01G046300 chr2B 88.976 127 11 2 2816 2939 110375410 110375284 1.480000e-33 154.0
41 TraesCS6B01G046300 chr5B 87.121 132 17 0 2942 3073 69818101 69817970 1.910000e-32 150.0
42 TraesCS6B01G046300 chr5B 88.189 127 10 3 2816 2939 69818319 69818195 2.470000e-31 147.0
43 TraesCS6B01G046300 chr5B 95.745 47 2 0 1391 1437 631466823 631466777 3.290000e-10 76.8
44 TraesCS6B01G046300 chr2D 90.909 99 9 0 2939 3037 95526760 95526858 1.920000e-27 134.0
45 TraesCS6B01G046300 chr1A 95.652 46 2 0 1392 1437 518805988 518805943 1.180000e-09 75.0
46 TraesCS6B01G046300 chr4B 92.308 52 3 1 1387 1437 626523018 626522967 4.250000e-09 73.1
47 TraesCS6B01G046300 chr4B 87.931 58 5 2 1379 1435 367296173 367296117 1.980000e-07 67.6
48 TraesCS6B01G046300 chr3A 89.474 57 5 1 1386 1441 514105505 514105449 1.530000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G046300 chr6B 27530818 27533890 3072 True 5675.000000 5675 100.000000 1 3073 1 chr6B.!!$R1 3072
1 TraesCS6B01G046300 chr6B 27484138 27487300 3162 True 2760.500000 5304 97.403500 1 3073 2 chr6B.!!$R4 3072
2 TraesCS6B01G046300 chr6B 27417936 27420849 2913 True 1652.000000 4257 98.339000 1 3073 3 chr6B.!!$R2 3072
3 TraesCS6B01G046300 chr6B 27454006 27456917 2911 True 1640.666667 4228 98.246333 1 3073 3 chr6B.!!$R3 3072
4 TraesCS6B01G046300 chrUn 441168662 441169750 1088 True 1956.000000 1956 99.082000 811 1899 1 chrUn.!!$R5 1088
5 TraesCS6B01G046300 chrUn 348953558 348954646 1088 False 1426.000000 1426 90.355000 1725 2816 1 chrUn.!!$F1 1091
6 TraesCS6B01G046300 chrUn 459176789 459177715 926 False 1267.000000 1267 91.318000 1725 2656 1 chrUn.!!$F2 931
7 TraesCS6B01G046300 chrUn 319196444 319198050 1606 True 999.000000 1526 90.296500 1013 2659 2 chrUn.!!$R6 1646
8 TraesCS6B01G046300 chrUn 76409200 76414085 4885 False 726.000000 977 89.331500 1449 2816 2 chrUn.!!$F3 1367
9 TraesCS6B01G046300 chr6D 15549899 15552769 2870 True 1202.666667 1712 89.219000 1 2816 3 chr6D.!!$R3 2815
10 TraesCS6B01G046300 chr6D 15599535 15600366 831 True 1016.000000 1016 89.087000 59 878 1 chr6D.!!$R2 819
11 TraesCS6B01G046300 chr6D 15585107 15589833 4726 True 967.500000 1515 89.055000 872 2816 2 chr6D.!!$R4 1944
12 TraesCS6B01G046300 chr6D 15639622 15640449 827 False 314.000000 468 89.354333 596 1528 3 chr6D.!!$F1 932
13 TraesCS6B01G046300 chr6A 16336554 16338023 1469 False 845.500000 1219 88.529000 1 1396 2 chr6A.!!$F1 1395

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1428 4438 8.293867 CGTTTCAAAATAGATGACCCAACTTTA 58.706 33.333 0.0 0.0 0.0 1.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3005 9771 1.305381 CTCCCCTCTTCGGTGGTCT 60.305 63.158 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1428 4438 8.293867 CGTTTCAAAATAGATGACCCAACTTTA 58.706 33.333 0.00 0.00 0.00 1.85
1806 4875 2.307686 GGATCAAACCCCAACTACCTCA 59.692 50.000 0.00 0.00 0.00 3.86
1874 4943 3.026694 GGAGCTAATGCAAACCAGGAAT 58.973 45.455 0.00 0.00 42.74 3.01
2042 5111 3.395702 TACTGGCGGCCGGACAAT 61.396 61.111 33.58 14.15 28.86 2.71
2616 9285 9.950858 CACACATTTTAGGCATTTAATTAAACG 57.049 29.630 12.74 6.22 0.00 3.60
2966 9732 6.753744 GGCAATGGAAAATCTTATGTTCAGAC 59.246 38.462 0.00 0.00 0.00 3.51
3005 9771 0.978151 TCCGGTGCTTAAGGCTGTTA 59.022 50.000 0.00 0.00 42.39 2.41
3058 9824 1.476891 GTGTCACTAAGGCATCCTCGA 59.523 52.381 0.00 0.00 32.25 4.04
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1428 4438 7.945134 ACGTACGTATTTCCTCCAGTTAATAT 58.055 34.615 21.41 0.0 0.00 1.28
1859 4928 0.614812 GCCCATTCCTGGTTTGCATT 59.385 50.000 0.00 0.0 41.37 3.56
1949 5018 3.011517 GAGAAGGGCCCCTGCAGA 61.012 66.667 21.43 0.0 40.13 4.26
2042 5111 0.034337 GGACGTTGGACCAGTAAGCA 59.966 55.000 0.00 0.0 0.00 3.91
2966 9732 3.302347 AAGAAGCGCACCCCGAGAG 62.302 63.158 11.47 0.0 40.02 3.20
3005 9771 1.305381 CTCCCCTCTTCGGTGGTCT 60.305 63.158 0.00 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.