Multiple sequence alignment - TraesCS6B01G046200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G046200 chr6B 100.000 3073 0 0 1 3073 27487300 27484228 0.000000e+00 5675.0
1 TraesCS6B01G046200 chr6B 99.251 2939 21 1 1 2938 27533890 27530952 0.000000e+00 5304.0
2 TraesCS6B01G046200 chr6B 98.826 2556 26 3 521 3073 27420580 27418026 0.000000e+00 4551.0
3 TraesCS6B01G046200 chr6B 98.238 2554 43 2 521 3073 27456648 27454096 0.000000e+00 4466.0
4 TraesCS6B01G046200 chr6B 99.617 261 1 0 1 261 27420849 27420589 7.710000e-131 477.0
5 TraesCS6B01G046200 chr6B 99.617 261 1 0 1 261 27456917 27456657 7.710000e-131 477.0
6 TraesCS6B01G046200 chr6B 96.800 125 4 0 1272 1396 27668934 27669058 3.100000e-50 209.0
7 TraesCS6B01G046200 chrUn 99.725 1089 3 0 811 1899 441169750 441168662 0.000000e+00 1995.0
8 TraesCS6B01G046200 chrUn 91.986 1123 77 8 1543 2658 319197560 319196444 0.000000e+00 1563.0
9 TraesCS6B01G046200 chrUn 90.992 1099 81 10 1725 2815 348953558 348954646 0.000000e+00 1465.0
10 TraesCS6B01G046200 chrUn 92.069 933 66 7 1725 2655 459176789 459177715 0.000000e+00 1306.0
11 TraesCS6B01G046200 chrUn 91.667 720 57 3 1449 2167 76409200 76409917 0.000000e+00 994.0
12 TraesCS6B01G046200 chrUn 92.180 422 23 7 747 1159 76417691 76417271 3.410000e-164 588.0
13 TraesCS6B01G046200 chrUn 92.180 422 23 7 747 1159 311042688 311042268 3.410000e-164 588.0
14 TraesCS6B01G046200 chrUn 89.019 428 28 3 2388 2815 76413677 76414085 2.110000e-141 512.0
15 TraesCS6B01G046200 chrUn 88.718 390 27 8 1013 1396 319198050 319197672 7.760000e-126 460.0
16 TraesCS6B01G046200 chrUn 88.718 390 27 8 1013 1396 347746851 347746473 7.760000e-126 460.0
17 TraesCS6B01G046200 chrUn 87.838 74 5 1 2742 2815 322192708 322192639 1.960000e-12 84.2
18 TraesCS6B01G046200 chrUn 87.838 74 5 1 2742 2815 425808720 425808651 1.960000e-12 84.2
19 TraesCS6B01G046200 chr6D 90.058 1388 98 16 1446 2815 15551264 15549899 0.000000e+00 1762.0
20 TraesCS6B01G046200 chr6D 88.975 1297 101 18 1541 2815 15586383 15585107 0.000000e+00 1565.0
21 TraesCS6B01G046200 chr6D 91.604 929 53 13 487 1396 15552184 15551262 0.000000e+00 1260.0
22 TraesCS6B01G046200 chr6D 89.087 843 58 10 59 878 15600366 15599535 0.000000e+00 1016.0
23 TraesCS6B01G046200 chr6D 86.644 599 51 11 1 580 15552769 15552181 1.200000e-178 636.0
24 TraesCS6B01G046200 chr6D 86.547 446 34 8 951 1396 15639950 15640369 4.640000e-128 468.0
25 TraesCS6B01G046200 chr6D 89.820 334 24 7 872 1195 15589833 15589500 1.320000e-113 420.0
26 TraesCS6B01G046200 chr6D 87.540 313 24 3 596 897 15639622 15639930 6.310000e-92 348.0
27 TraesCS6B01G046200 chr6D 92.208 154 12 0 6 159 15525182 15525029 5.160000e-53 219.0
28 TraesCS6B01G046200 chr6D 92.771 83 6 0 1446 1528 15640367 15640449 1.500000e-23 121.0
29 TraesCS6B01G046200 chr6A 89.785 979 62 15 1 955 16336554 16337518 0.000000e+00 1219.0
30 TraesCS6B01G046200 chr6A 87.273 440 22 16 988 1396 16337587 16338023 3.590000e-129 472.0
31 TraesCS6B01G046200 chr6A 94.771 153 8 0 6 158 16240139 16239987 3.960000e-59 239.0
32 TraesCS6B01G046200 chr2B 89.695 262 24 1 2815 3073 110375410 110375149 6.350000e-87 331.0
33 TraesCS6B01G046200 chr5B 89.313 262 23 3 2815 3073 69818319 69818060 1.060000e-84 324.0
34 TraesCS6B01G046200 chr5B 97.872 47 1 0 1391 1437 631466823 631466777 7.060000e-12 82.4
35 TraesCS6B01G046200 chr3B 88.327 257 26 3 2818 3073 680429346 680429093 3.850000e-79 305.0
36 TraesCS6B01G046200 chr3B 86.463 229 25 4 2851 3073 19911629 19911857 2.370000e-61 246.0
37 TraesCS6B01G046200 chr1B 87.833 263 27 3 2815 3073 115754348 115754609 1.380000e-78 303.0
38 TraesCS6B01G046200 chr4D 87.008 254 26 3 2815 3065 494005434 494005683 2.330000e-71 279.0
39 TraesCS6B01G046200 chr4A 84.211 247 36 1 2830 3073 620741711 620741957 1.420000e-58 237.0
40 TraesCS6B01G046200 chr1D 97.778 45 1 0 1393 1437 478229640 478229684 9.140000e-11 78.7
41 TraesCS6B01G046200 chr4B 94.000 50 3 0 1386 1435 600659587 600659538 3.290000e-10 76.8
42 TraesCS6B01G046200 chr2D 95.745 47 2 0 1391 1437 568125895 568125849 3.290000e-10 76.8
43 TraesCS6B01G046200 chr7A 90.566 53 5 0 1385 1437 727825339 727825391 1.530000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G046200 chr6B 27484228 27487300 3072 True 5675.000000 5675 100.000000 1 3073 1 chr6B.!!$R1 3072
1 TraesCS6B01G046200 chr6B 27530952 27533890 2938 True 5304.000000 5304 99.251000 1 2938 1 chr6B.!!$R2 2937
2 TraesCS6B01G046200 chr6B 27418026 27420849 2823 True 2514.000000 4551 99.221500 1 3073 2 chr6B.!!$R3 3072
3 TraesCS6B01G046200 chr6B 27454096 27456917 2821 True 2471.500000 4466 98.927500 1 3073 2 chr6B.!!$R4 3072
4 TraesCS6B01G046200 chrUn 441168662 441169750 1088 True 1995.000000 1995 99.725000 811 1899 1 chrUn.!!$R6 1088
5 TraesCS6B01G046200 chrUn 348953558 348954646 1088 False 1465.000000 1465 90.992000 1725 2815 1 chrUn.!!$F1 1090
6 TraesCS6B01G046200 chrUn 459176789 459177715 926 False 1306.000000 1306 92.069000 1725 2655 1 chrUn.!!$F2 930
7 TraesCS6B01G046200 chrUn 319196444 319198050 1606 True 1011.500000 1563 90.352000 1013 2658 2 chrUn.!!$R7 1645
8 TraesCS6B01G046200 chrUn 76409200 76414085 4885 False 753.000000 994 90.343000 1449 2815 2 chrUn.!!$F3 1366
9 TraesCS6B01G046200 chr6D 15549899 15552769 2870 True 1219.333333 1762 89.435333 1 2815 3 chr6D.!!$R3 2814
10 TraesCS6B01G046200 chr6D 15599535 15600366 831 True 1016.000000 1016 89.087000 59 878 1 chr6D.!!$R2 819
11 TraesCS6B01G046200 chr6D 15585107 15589833 4726 True 992.500000 1565 89.397500 872 2815 2 chr6D.!!$R4 1943
12 TraesCS6B01G046200 chr6D 15639622 15640449 827 False 312.333333 468 88.952667 596 1528 3 chr6D.!!$F1 932
13 TraesCS6B01G046200 chr6A 16336554 16338023 1469 False 845.500000 1219 88.529000 1 1396 2 chr6A.!!$F1 1395

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1899 4968 2.606519 CAACGGGGTCCTGGGAGA 60.607 66.667 0.48 0.0 0.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2999 9675 2.038952 TCCCAACAGATCCAAGACACAG 59.961 50.0 0.0 0.0 0.0 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1899 4968 2.606519 CAACGGGGTCCTGGGAGA 60.607 66.667 0.48 0.00 0.00 3.71
2839 9515 0.840617 TGGGTTGTGGTAGCTGACAA 59.159 50.000 0.00 0.00 0.00 3.18
2973 9649 6.410038 CGTTTGCGAAATGATTTTGTTTTCT 58.590 32.000 6.98 0.00 41.33 2.52
2987 9663 4.884668 TGTTTTCTAGGGACGAAGATGT 57.115 40.909 0.00 0.00 0.00 3.06
3030 9706 0.389817 TCTGTTGGGAGCAACGATCG 60.390 55.000 14.88 14.88 37.86 3.69
3062 9738 7.036220 GGAAAATCTTATGTTCAGAGTCTCGA 58.964 38.462 0.00 0.00 0.00 4.04
3068 9744 0.598562 GTTCAGAGTCTCGAGGTGCA 59.401 55.000 13.56 0.00 0.00 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2999 9675 2.038952 TCCCAACAGATCCAAGACACAG 59.961 50.0 0.0 0.0 0.0 3.66
3030 9706 5.976458 TGAACATAAGATTTTCCATTGCCC 58.024 37.5 0.0 0.0 0.0 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.