Multiple sequence alignment - TraesCS6B01G046000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G046000 chr6B 100.000 3073 0 0 1 3073 27421100 27418028 0.000000e+00 5675.0
1 TraesCS6B01G046000 chr6B 98.371 2824 44 1 250 3073 27456919 27454098 0.000000e+00 4959.0
2 TraesCS6B01G046000 chr6B 98.825 2554 26 3 521 3073 27486780 27484230 0.000000e+00 4547.0
3 TraesCS6B01G046000 chr6B 98.430 2421 35 3 521 2940 27533370 27530952 0.000000e+00 4257.0
4 TraesCS6B01G046000 chr6B 98.828 512 6 0 1 512 27487551 27487040 0.000000e+00 913.0
5 TraesCS6B01G046000 chr6B 98.633 512 7 0 1 512 27534141 27533630 0.000000e+00 907.0
6 TraesCS6B01G046000 chr6B 96.800 125 4 0 1272 1396 27668934 27669058 3.100000e-50 209.0
7 TraesCS6B01G046000 chrUn 100.000 1089 0 0 811 1899 441169750 441168662 0.000000e+00 2012.0
8 TraesCS6B01G046000 chrUn 91.362 1123 85 7 1543 2659 319197560 319196444 0.000000e+00 1526.0
9 TraesCS6B01G046000 chrUn 90.173 1099 92 9 1725 2817 348953558 348954646 0.000000e+00 1417.0
10 TraesCS6B01G046000 chrUn 91.318 933 74 6 1725 2656 459176789 459177715 0.000000e+00 1267.0
11 TraesCS6B01G046000 chrUn 91.528 720 58 3 1449 2167 76409200 76409917 0.000000e+00 989.0
12 TraesCS6B01G046000 chrUn 92.180 422 23 7 747 1159 76417691 76417271 3.410000e-164 588.0
13 TraesCS6B01G046000 chrUn 92.180 422 23 7 747 1159 311042688 311042268 3.410000e-164 588.0
14 TraesCS6B01G046000 chrUn 88.718 390 27 8 1013 1396 319198050 319197672 7.760000e-126 460.0
15 TraesCS6B01G046000 chrUn 88.718 390 27 8 1013 1396 347746851 347746473 7.760000e-126 460.0
16 TraesCS6B01G046000 chrUn 91.758 182 14 1 2525 2705 26385999 26386180 5.090000e-63 252.0
17 TraesCS6B01G046000 chrUn 86.486 74 6 2 2744 2817 322192708 322192639 9.140000e-11 78.7
18 TraesCS6B01G046000 chrUn 86.486 74 6 2 2744 2817 425808720 425808651 9.140000e-11 78.7
19 TraesCS6B01G046000 chr6D 89.345 1389 108 17 1446 2817 15551264 15549899 0.000000e+00 1709.0
20 TraesCS6B01G046000 chr6D 88.530 1299 105 22 1541 2817 15586383 15585107 0.000000e+00 1533.0
21 TraesCS6B01G046000 chr6D 91.955 895 50 11 521 1396 15552153 15551262 0.000000e+00 1234.0
22 TraesCS6B01G046000 chr6D 93.333 360 22 1 521 878 15599894 15599535 5.830000e-147 531.0
23 TraesCS6B01G046000 chr6D 86.547 446 34 8 951 1396 15639950 15640369 4.640000e-128 468.0
24 TraesCS6B01G046000 chr6D 88.398 362 31 1 162 512 15552859 15552498 2.830000e-115 425.0
25 TraesCS6B01G046000 chr6D 89.820 334 24 7 872 1195 15589833 15589500 1.320000e-113 420.0
26 TraesCS6B01G046000 chr6D 86.667 360 42 3 52 410 15525383 15525029 7.990000e-106 394.0
27 TraesCS6B01G046000 chr6D 87.540 313 24 3 596 897 15639622 15639930 6.310000e-92 348.0
28 TraesCS6B01G046000 chr6D 84.615 208 17 1 310 502 15600366 15600159 3.130000e-45 193.0
29 TraesCS6B01G046000 chr6D 92.771 83 6 0 1446 1528 15640367 15640449 1.500000e-23 121.0
30 TraesCS6B01G046000 chr6A 92.255 439 25 6 523 955 16337083 16337518 5.630000e-172 614.0
31 TraesCS6B01G046000 chr6A 86.983 484 46 8 44 512 16336347 16336828 2.100000e-146 529.0
32 TraesCS6B01G046000 chr6A 87.273 440 22 16 988 1396 16337587 16338023 3.590000e-129 472.0
33 TraesCS6B01G046000 chr6A 86.523 371 40 7 44 409 16240352 16239987 1.720000e-107 399.0
34 TraesCS6B01G046000 chr6A 87.584 298 30 4 2523 2817 16287971 16287678 3.800000e-89 339.0
35 TraesCS6B01G046000 chr2B 90.698 258 21 1 2819 3073 110375408 110375151 1.060000e-89 340.0
36 TraesCS6B01G046000 chr2B 100.000 43 0 0 1394 1436 98914388 98914346 2.540000e-11 80.5
37 TraesCS6B01G046000 chr5B 90.310 258 20 3 2819 3073 69818317 69818062 1.770000e-87 333.0
38 TraesCS6B01G046000 chr3B 90.234 256 19 5 2820 3073 680429346 680429095 2.280000e-86 329.0
39 TraesCS6B01G046000 chr3B 88.546 227 20 4 2853 3073 19911629 19911855 1.400000e-68 270.0
40 TraesCS6B01G046000 chr1B 88.417 259 25 3 2819 3073 115754350 115754607 1.070000e-79 307.0
41 TraesCS6B01G046000 chr4A 86.122 245 31 1 2832 3073 620741711 620741955 8.450000e-66 261.0
42 TraesCS6B01G046000 chr2D 82.879 257 41 1 2820 3073 431987140 431987396 8.570000e-56 228.0
43 TraesCS6B01G046000 chr3D 97.619 42 1 0 1394 1435 380303046 380303005 4.250000e-09 73.1
44 TraesCS6B01G046000 chr4B 92.000 50 4 0 1386 1435 600659587 600659538 1.530000e-08 71.3
45 TraesCS6B01G046000 chr7A 89.286 56 5 1 1394 1448 115795301 115795246 5.500000e-08 69.4
46 TraesCS6B01G046000 chr7B 87.719 57 7 0 1380 1436 198621817 198621873 1.980000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G046000 chr6B 27418028 27421100 3072 True 5675.000000 5675 100.000000 1 3073 1 chr6B.!!$R1 3072
1 TraesCS6B01G046000 chr6B 27454098 27456919 2821 True 4959.000000 4959 98.371000 250 3073 1 chr6B.!!$R2 2823
2 TraesCS6B01G046000 chr6B 27484230 27487551 3321 True 2730.000000 4547 98.826500 1 3073 2 chr6B.!!$R3 3072
3 TraesCS6B01G046000 chr6B 27530952 27534141 3189 True 2582.000000 4257 98.531500 1 2940 2 chr6B.!!$R4 2939
4 TraesCS6B01G046000 chrUn 441168662 441169750 1088 True 2012.000000 2012 100.000000 811 1899 1 chrUn.!!$R6 1088
5 TraesCS6B01G046000 chrUn 348953558 348954646 1088 False 1417.000000 1417 90.173000 1725 2817 1 chrUn.!!$F3 1092
6 TraesCS6B01G046000 chrUn 459176789 459177715 926 False 1267.000000 1267 91.318000 1725 2656 1 chrUn.!!$F4 931
7 TraesCS6B01G046000 chrUn 319196444 319198050 1606 True 993.000000 1526 90.040000 1013 2659 2 chrUn.!!$R7 1646
8 TraesCS6B01G046000 chrUn 76409200 76409917 717 False 989.000000 989 91.528000 1449 2167 1 chrUn.!!$F2 718
9 TraesCS6B01G046000 chr6D 15549899 15552859 2960 True 1122.666667 1709 89.899333 162 2817 3 chr6D.!!$R2 2655
10 TraesCS6B01G046000 chr6D 15585107 15589833 4726 True 976.500000 1533 89.175000 872 2817 2 chr6D.!!$R3 1945
11 TraesCS6B01G046000 chr6D 15599535 15600366 831 True 362.000000 531 88.974000 310 878 2 chr6D.!!$R4 568
12 TraesCS6B01G046000 chr6D 15639622 15640449 827 False 312.333333 468 88.952667 596 1528 3 chr6D.!!$F1 932
13 TraesCS6B01G046000 chr6A 16336347 16338023 1676 False 538.333333 614 88.837000 44 1396 3 chr6A.!!$F1 1352

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
248 249 1.458064 AGTACGTGCGGTTTCATTTCG 59.542 47.619 0.0 0.0 0.0 3.46 F
1985 5303 0.601046 CCATGCGTATCACCAGCGAT 60.601 55.000 0.0 0.0 0.0 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1985 5303 1.301401 CACAAGCGTCTTCCCGGAA 60.301 57.895 0.73 0.0 0.0 4.30 R
2817 6166 2.028130 CAGCTACAACAACCCAAACCA 58.972 47.619 0.00 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 124 5.243060 TCGACTAATGGTGGTATCTGTATGG 59.757 44.000 0.00 0.0 0.0 2.74
248 249 1.458064 AGTACGTGCGGTTTCATTTCG 59.542 47.619 0.00 0.0 0.0 3.46
1985 5303 0.601046 CCATGCGTATCACCAGCGAT 60.601 55.000 0.00 0.0 0.0 4.58
2402 5742 2.306847 ACCGGATTATCAACATTGGCC 58.693 47.619 9.46 0.0 0.0 5.36
2817 6166 7.956420 TGTATTTCGTTATGTTTCACTGACT 57.044 32.000 0.00 0.0 0.0 3.41
2830 6179 2.099405 CACTGACTGGTTTGGGTTGTT 58.901 47.619 0.00 0.0 0.0 2.83
3001 6350 1.063616 CGAAGATGGCGAAGTAGACGA 59.936 52.381 0.00 0.0 0.0 4.20
3028 6377 0.770499 TGGATCTGTTGGGAGCAACA 59.230 50.000 0.00 0.0 42.1 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 6.286240 AGTGAGTGCATTGAGTATGAACTA 57.714 37.500 0.00 0.0 35.56 2.24
123 124 4.184629 ACGTGAGATGCTTTCCTGAATAC 58.815 43.478 0.00 0.0 0.00 1.89
1985 5303 1.301401 CACAAGCGTCTTCCCGGAA 60.301 57.895 0.73 0.0 0.00 4.30
2788 6137 7.841277 CAGTGAAACATAACGAAATACATCGAG 59.159 37.037 3.47 0.0 42.27 4.04
2817 6166 2.028130 CAGCTACAACAACCCAAACCA 58.972 47.619 0.00 0.0 0.00 3.67
3001 6350 2.644299 TCCCAACAGATCCAAGACACAT 59.356 45.455 0.00 0.0 0.00 3.21
3028 6377 7.427989 ACATAAGATTTTCCATTGCCTGATT 57.572 32.000 0.00 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.