Multiple sequence alignment - TraesCS6B01G037500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G037500 chr6B 100.000 2531 0 0 1 2531 22001831 21999301 0.000000e+00 4674
1 TraesCS6B01G037500 chr6B 98.401 1814 23 1 724 2531 22075157 22073344 0.000000e+00 3184
2 TraesCS6B01G037500 chr6B 99.551 668 3 0 1 668 22075827 22075160 0.000000e+00 1218
3 TraesCS6B01G037500 chr7B 97.615 1971 42 5 561 2531 684309170 684311135 0.000000e+00 3374
4 TraesCS6B01G037500 chr7B 95.738 1971 69 14 562 2531 680386358 680384402 0.000000e+00 3160
5 TraesCS6B01G037500 chr5B 96.846 1966 51 9 567 2531 571605632 571603677 0.000000e+00 3277
6 TraesCS6B01G037500 chr5B 95.943 1972 68 11 562 2531 557255420 557257381 0.000000e+00 3188
7 TraesCS6B01G037500 chr2B 96.360 1978 56 12 562 2531 729905887 729907856 0.000000e+00 3240
8 TraesCS6B01G037500 chr2B 89.173 2032 106 38 560 2531 786020374 786018397 0.000000e+00 2429
9 TraesCS6B01G037500 chr4B 96.121 1985 53 17 562 2529 624601371 624603348 0.000000e+00 3217
10 TraesCS6B01G037500 chr4B 95.637 1971 69 15 562 2531 460863605 460861651 0.000000e+00 3147
11 TraesCS6B01G037500 chr1B 95.996 1973 64 14 562 2531 112411649 112409689 0.000000e+00 3192
12 TraesCS6B01G037500 chrUn 100.000 220 0 0 1 220 478058195 478058414 8.430000e-110 407


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G037500 chr6B 21999301 22001831 2530 True 4674 4674 100.000 1 2531 1 chr6B.!!$R1 2530
1 TraesCS6B01G037500 chr6B 22073344 22075827 2483 True 2201 3184 98.976 1 2531 2 chr6B.!!$R2 2530
2 TraesCS6B01G037500 chr7B 684309170 684311135 1965 False 3374 3374 97.615 561 2531 1 chr7B.!!$F1 1970
3 TraesCS6B01G037500 chr7B 680384402 680386358 1956 True 3160 3160 95.738 562 2531 1 chr7B.!!$R1 1969
4 TraesCS6B01G037500 chr5B 571603677 571605632 1955 True 3277 3277 96.846 567 2531 1 chr5B.!!$R1 1964
5 TraesCS6B01G037500 chr5B 557255420 557257381 1961 False 3188 3188 95.943 562 2531 1 chr5B.!!$F1 1969
6 TraesCS6B01G037500 chr2B 729905887 729907856 1969 False 3240 3240 96.360 562 2531 1 chr2B.!!$F1 1969
7 TraesCS6B01G037500 chr2B 786018397 786020374 1977 True 2429 2429 89.173 560 2531 1 chr2B.!!$R1 1971
8 TraesCS6B01G037500 chr4B 624601371 624603348 1977 False 3217 3217 96.121 562 2529 1 chr4B.!!$F1 1967
9 TraesCS6B01G037500 chr4B 460861651 460863605 1954 True 3147 3147 95.637 562 2531 1 chr4B.!!$R1 1969
10 TraesCS6B01G037500 chr1B 112409689 112411649 1960 True 3192 3192 95.996 562 2531 1 chr1B.!!$R1 1969

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
580 581 1.152881 GGCCCAATAGCTCCTGTGG 60.153 63.158 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2135 2180 0.249868 ATCTCACCACACACACACCG 60.25 55.0 0.0 0.0 0.0 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
580 581 1.152881 GGCCCAATAGCTCCTGTGG 60.153 63.158 0.00 0.00 0.00 4.17
674 675 4.273480 GTGTGTAAATAGCTCCAATGCGAT 59.727 41.667 0.00 0.00 38.13 4.58
884 904 3.847042 TCCCACCTTCTTCTTCCTCTA 57.153 47.619 0.00 0.00 0.00 2.43
1070 1090 0.800012 GGGCGCGAGTTTGTGAAATA 59.200 50.000 12.10 0.00 0.00 1.40
1815 1839 5.301805 GTGAGAAAATGGGTCCTGAGAAAAA 59.698 40.000 0.00 0.00 0.00 1.94
1965 1992 7.613585 TGCACTAAATTTTGTGATGGATCATT 58.386 30.769 29.06 0.00 39.30 2.57
2055 2099 8.629158 TGAGTTGCATGAAGTAAATTAGTTTGT 58.371 29.630 0.00 0.00 0.00 2.83
2135 2180 5.546526 TGGTTTGGCCAATATTTTGAAGAC 58.453 37.500 21.26 10.05 45.94 3.01
2468 2569 2.231540 CTTCCTCCTCCTCCTCCGGT 62.232 65.000 0.00 0.00 0.00 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 221 0.962356 GCTGGCCATTGTGTGCTAGT 60.962 55.000 5.51 0.0 38.24 2.57
580 581 4.744631 AGCAAATTCACATCAAAAACGTCC 59.255 37.500 0.00 0.0 0.00 4.79
674 675 3.965379 TCACGGTTAAACAGAGCCATA 57.035 42.857 0.00 0.0 0.00 2.74
1070 1090 1.870055 CGGCTGTGGCTTGCTCAAAT 61.870 55.000 0.00 0.0 38.73 2.32
1815 1839 3.769300 GGTCTCTATTTTGGGCATGGTTT 59.231 43.478 0.00 0.0 0.00 3.27
1970 1997 9.499479 ACAATCAACATTTGGTTTTATTGCATA 57.501 25.926 0.00 0.0 40.58 3.14
1991 2018 6.551736 ACCGTAGACATGCATAAAAACAATC 58.448 36.000 0.00 0.0 0.00 2.67
2135 2180 0.249868 ATCTCACCACACACACACCG 60.250 55.000 0.00 0.0 0.00 4.94
2468 2569 2.280524 CGAGGTGGCGTTGTTCCA 60.281 61.111 0.00 0.0 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.