Multiple sequence alignment - TraesCS6B01G036600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G036600 chr6B 100.000 2663 0 0 1 2663 21362097 21364759 0 4918
1 TraesCS6B01G036600 chr6A 98.874 2665 26 4 1 2663 12690992 12693654 0 4752
2 TraesCS6B01G036600 chr6A 98.837 2665 28 3 1 2663 591843360 591840697 0 4747
3 TraesCS6B01G036600 chr6A 98.311 2665 40 5 1 2663 87943545 87940884 0 4667
4 TraesCS6B01G036600 chr7A 98.799 2665 28 4 1 2663 624756692 624759354 0 4741
5 TraesCS6B01G036600 chr7A 98.313 2668 36 7 1 2663 634132807 634130144 0 4669
6 TraesCS6B01G036600 chr2B 98.424 2665 38 4 1 2663 608457624 608460286 0 4686
7 TraesCS6B01G036600 chr1B 98.460 2662 34 7 4 2663 637616823 637614167 0 4682
8 TraesCS6B01G036600 chr2A 98.276 2668 39 7 1 2663 389206954 389209619 0 4665
9 TraesCS6B01G036600 chr7B 98.275 2666 41 5 1 2663 194130141 194127478 0 4663


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G036600 chr6B 21362097 21364759 2662 False 4918 4918 100.000 1 2663 1 chr6B.!!$F1 2662
1 TraesCS6B01G036600 chr6A 12690992 12693654 2662 False 4752 4752 98.874 1 2663 1 chr6A.!!$F1 2662
2 TraesCS6B01G036600 chr6A 591840697 591843360 2663 True 4747 4747 98.837 1 2663 1 chr6A.!!$R2 2662
3 TraesCS6B01G036600 chr6A 87940884 87943545 2661 True 4667 4667 98.311 1 2663 1 chr6A.!!$R1 2662
4 TraesCS6B01G036600 chr7A 624756692 624759354 2662 False 4741 4741 98.799 1 2663 1 chr7A.!!$F1 2662
5 TraesCS6B01G036600 chr7A 634130144 634132807 2663 True 4669 4669 98.313 1 2663 1 chr7A.!!$R1 2662
6 TraesCS6B01G036600 chr2B 608457624 608460286 2662 False 4686 4686 98.424 1 2663 1 chr2B.!!$F1 2662
7 TraesCS6B01G036600 chr1B 637614167 637616823 2656 True 4682 4682 98.460 4 2663 1 chr1B.!!$R1 2659
8 TraesCS6B01G036600 chr2A 389206954 389209619 2665 False 4665 4665 98.276 1 2663 1 chr2A.!!$F1 2662
9 TraesCS6B01G036600 chr7B 194127478 194130141 2663 True 4663 4663 98.275 1 2663 1 chr7B.!!$R1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
914 916 0.534877 TGCTCAGTTGCACCGAACAT 60.535 50.0 0.0 0.0 38.12 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2552 2566 2.270352 ACCCAAAGTTCAGCATCGAA 57.73 45.0 0.0 0.0 0.0 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
282 283 5.070047 GGATGAAATGCCTCCTCAATCAAAT 59.930 40.000 0.00 0.00 0.00 2.32
521 523 1.424302 CAATCAGGGGGCTCATCATCT 59.576 52.381 0.00 0.00 0.00 2.90
914 916 0.534877 TGCTCAGTTGCACCGAACAT 60.535 50.000 0.00 0.00 38.12 2.71
931 933 0.652592 CATGCTACCTAGTTGCGCAC 59.347 55.000 11.12 5.61 37.12 5.34
1192 1196 2.362077 GCCCAGTTGAACAGAAACATGT 59.638 45.455 0.00 0.00 33.96 3.21
1208 1212 2.158682 ACATGTTCCCTAGTTGTGTGCA 60.159 45.455 0.00 0.00 0.00 4.57
1211 1215 2.092646 TGTTCCCTAGTTGTGTGCACTT 60.093 45.455 19.41 1.23 0.00 3.16
1304 1309 0.837272 ACCATAACAGGCCGTGCTAT 59.163 50.000 0.00 0.00 0.00 2.97
1391 1398 1.949525 GGTTGCACAGAACATCAGTGT 59.050 47.619 5.07 0.00 36.43 3.55
1853 1860 4.508662 CCTTTGTTGGCAACTGGTTAAAA 58.491 39.130 28.71 18.41 33.82 1.52
2308 2320 3.278574 TGCTTGTGTTCTACTGCAACTT 58.721 40.909 0.00 0.00 36.85 2.66
2552 2566 6.092670 CGTCAATGTCAATAATCTGGAAGTGT 59.907 38.462 0.00 0.00 33.76 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
282 283 4.620723 TGTTCCTCTCCCTTATCTGCTTA 58.379 43.478 0.00 0.00 0.00 3.09
914 916 1.445410 CGTGCGCAACTAGGTAGCA 60.445 57.895 14.00 6.06 35.27 3.49
931 933 4.661993 TTATGCTCAAACTAACACAGCG 57.338 40.909 0.00 0.00 32.43 5.18
1109 1113 3.064931 GTTTTGGAGTCGGTGAAGGTAG 58.935 50.000 0.00 0.00 0.00 3.18
1192 1196 2.948979 CAAAGTGCACACAACTAGGGAA 59.051 45.455 21.04 0.00 0.00 3.97
1194 1198 2.297701 ACAAAGTGCACACAACTAGGG 58.702 47.619 21.04 0.22 0.00 3.53
1208 1212 6.064717 AGCTTGATCCTCAAACTAACAAAGT 58.935 36.000 0.00 0.00 41.49 2.66
1211 1215 8.458573 TTTTAGCTTGATCCTCAAACTAACAA 57.541 30.769 10.64 7.39 41.76 2.83
1391 1398 9.817809 TTAGTATTTTTGTTATTGTGCAACCAA 57.182 25.926 0.00 0.00 34.36 3.67
2257 2269 4.798907 CAGTAGGACATAAGTAGTTGCACG 59.201 45.833 0.00 0.00 0.00 5.34
2308 2320 5.943416 AGTAGTTGCAAAGTGGCACATAATA 59.057 36.000 21.41 0.00 44.86 0.98
2552 2566 2.270352 ACCCAAAGTTCAGCATCGAA 57.730 45.000 0.00 0.00 0.00 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.