Multiple sequence alignment - TraesCS6B01G036500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G036500 chr6B 100.000 2291 0 0 1 2291 21286399 21288689 0 4231
1 TraesCS6B01G036500 chr6B 91.032 2297 198 4 1 2291 10539553 10541847 0 3094
2 TraesCS6B01G036500 chr6B 91.100 2281 202 1 1 2280 10409129 10411409 0 3086
3 TraesCS6B01G036500 chr6B 91.104 2282 200 3 1 2280 10474165 10476445 0 3086
4 TraesCS6B01G036500 chr1B 95.111 2291 105 1 1 2291 671269269 671271552 0 3603
5 TraesCS6B01G036500 chr6A 94.758 2289 120 0 1 2289 614422197 614419909 0 3563
6 TraesCS6B01G036500 chr1A 94.238 2291 125 6 1 2291 72429906 72427623 0 3493
7 TraesCS6B01G036500 chr5A 93.715 2291 144 0 1 2291 297713728 297716018 0 3434
8 TraesCS6B01G036500 chr7A 95.015 1705 84 1 1 1705 484216260 484214557 0 2676
9 TraesCS6B01G036500 chr3B 82.029 2326 367 27 1 2291 43035081 43037390 0 1932
10 TraesCS6B01G036500 chr2B 90.606 1288 120 1 994 2280 350297958 350296671 0 1707
11 TraesCS6B01G036500 chr3A 90.901 1176 97 6 1 1167 102695562 102694388 0 1570


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G036500 chr6B 21286399 21288689 2290 False 4231 4231 100.000 1 2291 1 chr6B.!!$F4 2290
1 TraesCS6B01G036500 chr6B 10539553 10541847 2294 False 3094 3094 91.032 1 2291 1 chr6B.!!$F3 2290
2 TraesCS6B01G036500 chr6B 10409129 10411409 2280 False 3086 3086 91.100 1 2280 1 chr6B.!!$F1 2279
3 TraesCS6B01G036500 chr6B 10474165 10476445 2280 False 3086 3086 91.104 1 2280 1 chr6B.!!$F2 2279
4 TraesCS6B01G036500 chr1B 671269269 671271552 2283 False 3603 3603 95.111 1 2291 1 chr1B.!!$F1 2290
5 TraesCS6B01G036500 chr6A 614419909 614422197 2288 True 3563 3563 94.758 1 2289 1 chr6A.!!$R1 2288
6 TraesCS6B01G036500 chr1A 72427623 72429906 2283 True 3493 3493 94.238 1 2291 1 chr1A.!!$R1 2290
7 TraesCS6B01G036500 chr5A 297713728 297716018 2290 False 3434 3434 93.715 1 2291 1 chr5A.!!$F1 2290
8 TraesCS6B01G036500 chr7A 484214557 484216260 1703 True 2676 2676 95.015 1 1705 1 chr7A.!!$R1 1704
9 TraesCS6B01G036500 chr3B 43035081 43037390 2309 False 1932 1932 82.029 1 2291 1 chr3B.!!$F1 2290
10 TraesCS6B01G036500 chr2B 350296671 350297958 1287 True 1707 1707 90.606 994 2280 1 chr2B.!!$R1 1286
11 TraesCS6B01G036500 chr3A 102694388 102695562 1174 True 1570 1570 90.901 1 1167 1 chr3A.!!$R1 1166

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
267 269 1.026182 TCCAGCAATCGCGCAAGAAT 61.026 50.0 8.75 0.0 45.49 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2212 2253 0.672401 GACTTCCCAACGATTGCCGA 60.672 55.0 0.0 0.0 41.76 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
267 269 1.026182 TCCAGCAATCGCGCAAGAAT 61.026 50.000 8.75 0.00 45.49 2.40
410 412 2.032528 CTTCCGTTGCCTCAGCCA 59.967 61.111 0.00 0.00 38.69 4.75
445 447 4.105577 AGTAGACTGTAGAGACCCTCTCA 58.894 47.826 0.00 0.00 45.73 3.27
578 589 2.111999 CTGACCTTTCCACCTCCGCA 62.112 60.000 0.00 0.00 0.00 5.69
583 594 1.651240 CTTTCCACCTCCGCATGCAG 61.651 60.000 19.57 6.53 0.00 4.41
875 886 4.329545 GGCGCACAAGGACCTGGA 62.330 66.667 10.83 0.00 0.00 3.86
967 978 1.596934 GTCCGGCTCAAGTGGATGA 59.403 57.895 0.00 0.00 33.63 2.92
1009 1020 4.891037 GGCTCCCCATGCAGCTCC 62.891 72.222 8.82 0.00 35.82 4.70
1847 1861 1.608717 CCCTCGCTACTTGCTCCACT 61.609 60.000 0.00 0.00 40.11 4.00
2023 2064 1.085091 GCCTCTCTACTTCGACGACA 58.915 55.000 0.00 0.00 0.00 4.35
2063 2104 0.250513 GGCTCTTTCGACATGGGTCT 59.749 55.000 0.00 0.00 42.05 3.85
2212 2253 1.294780 CTCTTCTCCAAGCCAGCGT 59.705 57.895 0.00 0.00 0.00 5.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 4.853142 ACCGCTGGATCCGCCCTA 62.853 66.667 18.69 0.00 34.97 3.53
282 284 3.062763 CTGCCTAGCACTAAATGGATCG 58.937 50.000 0.00 0.00 33.79 3.69
410 412 1.028868 GTCTACTCTACGGTGGCGGT 61.029 60.000 0.00 0.00 0.00 5.68
755 766 2.356818 GATCGCTCGACCAAGGGAGG 62.357 65.000 0.00 0.00 40.97 4.30
967 978 0.460811 ATGACGACACGAGCATGCAT 60.461 50.000 21.98 4.75 0.00 3.96
1332 1344 1.313091 CGTCGTCATCAGAGGGGACA 61.313 60.000 7.60 0.00 0.00 4.02
1671 1685 4.308458 CACAGTTGTCGGCCCCGA 62.308 66.667 5.12 5.12 46.87 5.14
1766 1780 2.685999 GGGCCATGCTCTTTCCCT 59.314 61.111 4.39 0.00 34.19 4.20
2023 2064 2.586792 GCTGCCTCCGTCTTCCAT 59.413 61.111 0.00 0.00 0.00 3.41
2212 2253 0.672401 GACTTCCCAACGATTGCCGA 60.672 55.000 0.00 0.00 41.76 5.54


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.