Multiple sequence alignment - TraesCS6B01G028100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G028100 chr6B 100.000 2797 0 0 1 2797 16682801 16685597 0.000000e+00 5166.0
1 TraesCS6B01G028100 chr6B 99.571 2798 11 1 1 2797 16627622 16630419 0.000000e+00 5099.0
2 TraesCS6B01G028100 chr6B 90.623 1461 108 10 541 1974 16995803 16997261 0.000000e+00 1912.0
3 TraesCS6B01G028100 chr6B 98.788 825 9 1 1974 2797 15303406 15304230 0.000000e+00 1467.0
4 TraesCS6B01G028100 chr6B 98.785 823 9 1 1976 2797 52434533 52433711 0.000000e+00 1463.0
5 TraesCS6B01G028100 chr6B 79.575 1082 179 22 627 1678 16547445 16546376 0.000000e+00 736.0
6 TraesCS6B01G028100 chr6B 92.035 113 8 1 381 492 16985599 16985711 1.040000e-34 158.0
7 TraesCS6B01G028100 chr6D 95.310 1983 84 6 1 1975 9113483 9115464 0.000000e+00 3138.0
8 TraesCS6B01G028100 chr6D 80.278 1080 180 17 627 1678 9027229 9028303 0.000000e+00 784.0
9 TraesCS6B01G028100 chr6D 76.594 1051 191 34 662 1678 9215841 9216870 6.860000e-146 527.0
10 TraesCS6B01G028100 chrUn 99.616 1301 4 1 1 1300 359222918 359224218 0.000000e+00 2374.0
11 TraesCS6B01G028100 chrUn 98.785 823 9 1 1976 2797 310459497 310458675 0.000000e+00 1463.0
12 TraesCS6B01G028100 chr6A 88.952 1412 129 14 590 1975 9946605 9948015 0.000000e+00 1718.0
13 TraesCS6B01G028100 chr6A 88.739 1412 132 13 590 1975 9855896 9857306 0.000000e+00 1701.0
14 TraesCS6B01G028100 chr6A 79.349 1075 185 17 631 1678 9519566 9520630 0.000000e+00 721.0
15 TraesCS6B01G028100 chr5B 98.905 822 9 0 1976 2797 687135002 687135823 0.000000e+00 1469.0
16 TraesCS6B01G028100 chr5B 90.244 41 4 0 482 522 49487111 49487151 1.000000e-03 54.7
17 TraesCS6B01G028100 chr7B 98.785 823 9 1 1976 2797 693345619 693346441 0.000000e+00 1463.0
18 TraesCS6B01G028100 chr3B 98.663 823 10 1 1976 2797 742078699 742079521 0.000000e+00 1458.0
19 TraesCS6B01G028100 chr1B 98.663 823 9 2 1976 2797 47084169 47084990 0.000000e+00 1458.0
20 TraesCS6B01G028100 chr1B 98.663 823 9 2 1976 2797 645567862 645567041 0.000000e+00 1458.0
21 TraesCS6B01G028100 chr7D 96.094 384 12 1 1 381 620867564 620867181 8.510000e-175 623.0
22 TraesCS6B01G028100 chr5D 95.833 384 13 1 1 381 92645529 92645146 3.960000e-173 617.0
23 TraesCS6B01G028100 chr5D 95.833 384 13 1 1 381 104896141 104895758 3.960000e-173 617.0
24 TraesCS6B01G028100 chr1D 95.833 384 13 1 1 381 258836018 258835635 3.960000e-173 617.0
25 TraesCS6B01G028100 chr1D 95.833 384 13 1 1 381 412376860 412376477 3.960000e-173 617.0
26 TraesCS6B01G028100 chr1A 94.737 399 16 3 1 395 368142529 368142926 1.420000e-172 616.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G028100 chr6B 16682801 16685597 2796 False 5166 5166 100.000 1 2797 1 chr6B.!!$F3 2796
1 TraesCS6B01G028100 chr6B 16627622 16630419 2797 False 5099 5099 99.571 1 2797 1 chr6B.!!$F2 2796
2 TraesCS6B01G028100 chr6B 16995803 16997261 1458 False 1912 1912 90.623 541 1974 1 chr6B.!!$F5 1433
3 TraesCS6B01G028100 chr6B 15303406 15304230 824 False 1467 1467 98.788 1974 2797 1 chr6B.!!$F1 823
4 TraesCS6B01G028100 chr6B 52433711 52434533 822 True 1463 1463 98.785 1976 2797 1 chr6B.!!$R2 821
5 TraesCS6B01G028100 chr6B 16546376 16547445 1069 True 736 736 79.575 627 1678 1 chr6B.!!$R1 1051
6 TraesCS6B01G028100 chr6D 9113483 9115464 1981 False 3138 3138 95.310 1 1975 1 chr6D.!!$F2 1974
7 TraesCS6B01G028100 chr6D 9027229 9028303 1074 False 784 784 80.278 627 1678 1 chr6D.!!$F1 1051
8 TraesCS6B01G028100 chr6D 9215841 9216870 1029 False 527 527 76.594 662 1678 1 chr6D.!!$F3 1016
9 TraesCS6B01G028100 chrUn 359222918 359224218 1300 False 2374 2374 99.616 1 1300 1 chrUn.!!$F1 1299
10 TraesCS6B01G028100 chrUn 310458675 310459497 822 True 1463 1463 98.785 1976 2797 1 chrUn.!!$R1 821
11 TraesCS6B01G028100 chr6A 9946605 9948015 1410 False 1718 1718 88.952 590 1975 1 chr6A.!!$F3 1385
12 TraesCS6B01G028100 chr6A 9855896 9857306 1410 False 1701 1701 88.739 590 1975 1 chr6A.!!$F2 1385
13 TraesCS6B01G028100 chr6A 9519566 9520630 1064 False 721 721 79.349 631 1678 1 chr6A.!!$F1 1047
14 TraesCS6B01G028100 chr5B 687135002 687135823 821 False 1469 1469 98.905 1976 2797 1 chr5B.!!$F2 821
15 TraesCS6B01G028100 chr7B 693345619 693346441 822 False 1463 1463 98.785 1976 2797 1 chr7B.!!$F1 821
16 TraesCS6B01G028100 chr3B 742078699 742079521 822 False 1458 1458 98.663 1976 2797 1 chr3B.!!$F1 821
17 TraesCS6B01G028100 chr1B 47084169 47084990 821 False 1458 1458 98.663 1976 2797 1 chr1B.!!$F1 821
18 TraesCS6B01G028100 chr1B 645567041 645567862 821 True 1458 1458 98.663 1976 2797 1 chr1B.!!$R1 821

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
552 557 0.697658 TCTCATGTGCACCCAATCCA 59.302 50.0 15.69 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2165 2205 1.313475 CTGTAGGGGGCCCAGACTA 59.687 63.158 26.86 19.38 38.92 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 6.817641 CCTTATTTTGAAGCATTGCAATACCA 59.182 34.615 12.53 4.99 0.00 3.25
418 422 5.662597 CACTTATATAAGGGGAGGTAGGGT 58.337 45.833 23.24 0.00 37.62 4.34
510 515 7.683578 CAGGATGAAGGGTATTATCTCATCAA 58.316 38.462 11.32 0.00 39.69 2.57
552 557 0.697658 TCTCATGTGCACCCAATCCA 59.302 50.000 15.69 0.00 0.00 3.41
2165 2205 0.185901 AGTGGTGGCAGGATGTTGTT 59.814 50.000 0.00 0.00 39.31 2.83
2180 2220 0.119561 TTGTTAGTCTGGGCCCCCTA 59.880 55.000 22.27 14.04 36.94 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
418 422 2.677914 TCGGAAGATTGGATGCCTAGA 58.322 47.619 0.00 0.00 33.31 2.43
510 515 2.895424 CGGTTGGTTCAGGCCCTCT 61.895 63.158 0.00 0.00 0.00 3.69
552 557 1.496001 TGGTGGCATGCATAGAGGATT 59.504 47.619 21.36 0.00 0.00 3.01
2165 2205 1.313475 CTGTAGGGGGCCCAGACTA 59.687 63.158 26.86 19.38 38.92 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.